|
|
198516-AAV5 |
pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE (AAV5) |
|
Yizhar |
Apr 10, 2024 |
|
|
198516-AAV1 |
pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE (AAV1) |
|
Yizhar |
Apr 10, 2024 |
|
|
198516-Vdna |
pAAV_EF1a-DIO-PdCO-mScarlet-ER-miniWPRE (Virus associated DNA) |
|
Yizhar |
Apr 10, 2024 |
|
|
216757 |
pCAX-SCLM |
SuperClomeleon (Other)
|
Augustine |
Apr 10, 2024 |
|
|
214322 |
pET28_human-pro-IL-18_E192K_D193K |
IL18 (Homo sapiens)
|
Kagan |
Apr 10, 2024 |
|
|
202199-AAV5 |
pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE (AAV5) |
|
Yizhar |
Apr 10, 2024 |
|
|
202199-Vdna |
pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE (Virus associated DNA) |
|
Yizhar |
Apr 10, 2024 |
|
|
202199-AAV1 |
pAAV_hSyn-SIO-stChrimsonR-EGFP-P2A-PdCO-miniWPRE (AAV1) |
|
Yizhar |
Apr 10, 2024 |
|
|
213480 |
pXJ218-pAAV-PB3'IR-U6-gRNA-directcapture-EF1a-mtagBFP2-KASH-PB5'IR |
mtagBFP-KASH, U6-gRNA-directcapture
|
Jin |
Apr 10, 2024 |
|
|
139504-AAV5 |
pAAV-CAG-DIO-PPO-Venus (AAV5) |
|
Bruchas |
Apr 10, 2024 |
|
|
139504-Vdna |
pAAV-CAG-DIO-PPO-Venus (Virus associated DNA) |
|
Bruchas |
Apr 10, 2024 |
|
|
208286 |
OptoProfilin |
Cry2 - mCherry - Profilin.WT (Mus musculus)
|
Hughes |
Apr 10, 2024 |
|
|
208287 |
OptoProfilin.S138E |
Cry2 - mCherry - Profilin.S138E (Mus musculus)
|
Hughes |
Apr 10, 2024 |
|
|
208288 |
OptoProfilin.S138A |
Cry2 - mCherry - Profilin (Mus musculus)
|
Hughes |
Apr 10, 2024 |
|
|
216807 |
rSirt3 shRNA (pLKO.1 vector) |
Sirt3 (Rattus norvegicus)
|
Ashrafi |
Apr 10, 2024 |
|
|
216806 |
hSirt3-RFP |
Sirt3 (Homo sapiens)
|
Ashrafi |
Apr 10, 2024 |
|
|
208163 |
CN4801-rAAV-3xCore2_eHGT_390m-minBglobin-iCre(R297T)-BGHpA |
iCreR297T (Synthetic)
|
Ting |
Apr 10, 2024 |
|
|
215061 |
mAzGreen-Cyclin D3-NeoR |
CCND3 (Homo sapiens)
|
Pagano |
Apr 10, 2024 |
|
|
215062 |
mAzGreen-Cyclin D2-NeoR |
CCND2 (Homo sapiens)
|
Pagano |
Apr 10, 2024 |
|
|
215318 |
CCND2 targeting gRNA |
hSpCas9 (Synthetic)
|
Pagano |
Apr 10, 2024 |
|
|
215145 |
NTHL1-mCherry |
NTHL1 (Homo sapiens)
|
Pagano |
Apr 10, 2024 |
|
|
215141 |
mCherry-POLL |
POLL
|
Pagano |
Apr 10, 2024 |
|
|
215139 |
mCherry-POLD1 |
POLD1 (Homo sapiens)
|
Pagano |
Apr 10, 2024 |
|
|
215120 |
AcGFP-MLH1 |
MLH1 (Homo sapiens)
|
Pagano |
Apr 10, 2024 |
|
|
215115 |
SS-Cyclin D2 |
CCND2 (Homo sapiens)
|
Pagano |
Apr 10, 2024 |
|
|
215052 |
EGFP-Cyclin D3 |
CCND3 (Homo sapiens)
|
Pagano |
Apr 10, 2024 |
|
|
213111 |
pkk223_Null |
No insert
|
Horvath |
Apr 09, 2024 |
|
|
213110 |
pkk223_EcMutY |
MutY (adenine glycosylase) (Other)
|
Horvath |
Apr 09, 2024 |
|
|
214767 |
pMSCV-IRES-GFP/CREB3L1 |
CREB3L1 (Homo sapiens)
|
Komatsu |
Apr 09, 2024 |
|
|
214768 |
pMSCV-IRES-mOrange/CALR del52 |
human CALR del52 (Homo sapiens)
|
Komatsu |
Apr 09, 2024 |
|
|
214769 |
pMSCV-IRES-mOrange/CALR ins5 |
human CALR ins5 (Homo sapiens)
|
Komatsu |
Apr 09, 2024 |
|
|
214807 |
pMSCV-IRES-mOrange |
|
Komatsu |
Apr 09, 2024 |
|
|
214356 |
pAAV-SlugABE-NNG |
SlugABE-NNG (Synthetic)
|
Wang |
Apr 09, 2024 |
|
|
212613 |
Noodles Plasmid |
|
Vinnikov |
Apr 09, 2024 |
|
|
217342 |
gCH134 (crCD55-4_crB2M-1_crB2M-3_crKIT-2_crKIT-3_crCD81-1) |
crCD55-4 gRNA: actggtattgcggagccacgagg (Homo sapiens), crB2M-1 gRNA: atataagtggaggcgtcgcgctg (Homo sapiens), crB2M-3 gRNA: aggaatgcccgccagcgcgacgc (Homo sapiens), crKIT-2 gRNA: tctgcgttctgctcctactgctt (Homo sapiens), crKIT-3 gRNA: agctctcgcccaagtgcagcgag (Homo sapiens), crCD81-1 gRNA: ggcgcgacccccaggaaggtctc (Homo sapiens)
|
Gilbert |
Apr 09, 2024 |
|
|
214990 |
mNeonGreen-P2A-3xFLAG-msEEA1 HDR template |
EEA1 (Mus musculus)
|
Harper |
Apr 09, 2024 |
|
|
214209 |
pDSG467 |
AraC, trpC
|
Alon |
Apr 09, 2024 |
|
|
214983 |
pLV UBC APEX2-3xFLAG-IRES-eGFP |
APEX2 (Other)
|
Harper |
Apr 09, 2024 |
|
|
214998 |
hTMEM115-TEV-3xHA-P2A-mScarlet HDR template |
hTMEM115-TEV-3xHA-P2A-mScarlet HDR template (Homo sapiens)
|
Harper |
Apr 09, 2024 |
|
|
213927 |
LV2btCRISPRko.v1 |
na
|
Tan |
Apr 09, 2024 |
|
|
213928 |
PBbtCRISPRko.v1 |
na
|
Tan |
Apr 09, 2024 |
|
|
214999 |
hTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template |
hTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template (Homo sapiens)
|
Harper |
Apr 09, 2024 |
|
|
215000 |
pTwist Amp msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template |
msTMEM115-TEV-3C-P2A-mScarlet-I HDR Template (Mus musculus)
|
Harper |
Apr 09, 2024 |
|
|
217376 |
Lenti-mApple-6xHp |
mApple-6x Hp NC (Homo sapiens)
|
Chang |
Apr 09, 2024 |
|
|
212694 |
pCfB10769 |
gRNA targeting to the intergradtion site E2 (Other)
|
Borodina |
Apr 09, 2024 |
|
|
216503 |
pcDNA3 Ras-LOCKR-PL Key |
Ras-LOCKR-PL Key (Homo sapiens)
|
Baker |
Apr 09, 2024 |
|
|
216502 |
pcDNA3 Ras-LOCKR-PL Cage |
Ras-LOCKR-PL Cage (Homo sapiens)
|
Baker |
Apr 09, 2024 |
|
|
216497 |
pcDNA3 Ras-LOCKR-S R89L (negative control) |
Ras-LOCKR-S R89L negative control (Homo sapiens)
|
Baker |
Apr 09, 2024 |
|
|
216496 |
pcDNA3 Ras-LOCKR-S |
Ras-LOCKR-S (Homo sapiens)
|
Baker |
Apr 09, 2024 |
|
|
214467 |
pHelper_TS_V2_ampR |
CspRecT / Bxb-1 (Synthetic)
|
Saunders |
Apr 09, 2024 |
