hTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template
(Plasmid #214999)

• Purpose: Endogenously tag human TMEM115 with a C-terminal 3xHA tag in addition to cytosolic mNG for cell sorting.
• Depositing Lab: Wade Harper
• Publication: Hollingsworth et al bioRxiv 2024.04.19.590338

Backbone

• Vector backbone: pTwist-Amp
• Vector type: HDR template
• Selectable markers: mNeonGreen

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: hTMEM115-TEV-3xHA-P2A-mNeonGreen HDR template
• Species: H. sapiens (human)
• Entrez Gene: TMEM115 (a.k.a. PL6)
• Promoter: None
• Tag / Fusion Protein:
  • 3xHA (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: Unknown

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • mNeonGreen Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Use either of the following guides: GTCTGGAGTTACAGCGTCGGGGG or CCGCTCATTGAGTGCCTTCAGGG (in both cases, the PAM is the final GGG) . Additional data, code, and other details related to this work (Hollingsworth et al. 2024) are available at https://harperlab.pubpub.org/pub/nlrp3/.