Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Recently Deposited Plasmids


ID Plasmid Gene/Insert PI Available On
214141 delCMV-mCherry-3x-p67phox-GBD 3xp67phox-GBD (Homo sapiens) Dehmelt Apr 12, 2024
213720 psgRNA-GST-EGFP-GPIBY55 EGFP (Homo sapiens) Huang Apr 12, 2024
213719 psgRNA-GST-EGFP-GPIDAF EGFP (Homo sapiens) Huang Apr 12, 2024
212038 Sp_PE PE2 (Synthetic) Ji Apr 12, 2024
212039 pegRNA2_tevopreQ1 pegRNA (Synthetic) Ji Apr 12, 2024
212040 pBbS8c_ddCpf1_final ddCpf1 (Synthetic) Ji Apr 12, 2024
210238 pUdO1s Campbell-Valois Apr 12, 2024
121529 mOrange in pBSDONR P4r-P2 mOrange (Other) Innes Apr 12, 2024
1000000241 GreenGate 2.0 Toolkit Maizel Apr 11, 2024
216759 pAAV/EF1a-DIO-SCLM SuperClomeleon (Other) Augustine Apr 11, 2024
210243 pUdO2te Campbell-Valois Apr 11, 2024
210258 pTSAR3.6t mScarlet (Synthetic), superfolder GFP (Other) Campbell-Valois Apr 11, 2024
217495 pKJ318 MmFnuc guide RNA scaffold (Other) Abudayyeh Apr 11, 2024
210320 pUdOanc-a Campbell-Valois Apr 11, 2024
217533 pAAV-S5E2-FingR-PSD95-mGL ZnF-FingR-PSD95-mGreenLantern (Mus musculus) Scheiffele Apr 11, 2024
217534 pAAV-BRX-eGFP-NLS BMP reporter element and miniXon casette (Mus musculus) Scheiffele Apr 11, 2024
177899 pFastBac(His10-Shp2) Shp2 (Homo sapiens) Vale Apr 11, 2024
161623 IDG_PKD2L2_OE_1 PKD2L2 (Homo sapiens) McManus Apr 11, 2024
213010 GfaABC1D-jGCaMP8m GfaABC1D-jGCaMP8m (Mus musculus) Khakh Apr 10, 2024
200067 U6-sgRNAs-Crym U6-3xsgRNA-Crym (Mus musculus) Khakh Apr 10, 2024
200068 U6-sgRNA-GFP U6-sgRNA-GFP (Mus musculus) Khakh Apr 10, 2024
200070 GfaABC1D-Crym-BioID2-BioID2 GfaABC1D-Crym-BioID2-BioID2 (Mus musculus) Khakh Apr 10, 2024
200080 GfaABC1D-Crym-eGFP GfaABC1D-Crym-eGFP (Mus musculus) Khakh Apr 10, 2024
1000000240 MoClo Yeast Secretion and Display (YSD) Toolkit Young Apr 10, 2024
214706 pMSCV-IRES-GFP/CALR ins5 YD/FL-FLAG CALR ins5 YD/FL-FLAG (Homo sapiens) Komatsu Apr 10, 2024
207555 ATG5 sgRNA AACTTGTTTCACGCTATATC (Homo sapiens) Schmidt Apr 10, 2024
207539 Halo-LC3B HRD HaloTag with internal PuroR cassette flanked by human LC3B locus sequences (Homo sapiens) Schmidt Apr 10, 2024
217492 pKJ234 DpFnuc (Other) Abudayyeh Apr 10, 2024
217535 pAAV-2xflox-BRX-eGFP-NLS 4X BRE reporter and miniXon casette (Mus musculus) Scheiffele Apr 10, 2024
214927 pLX304_miRFP670nano-P2A-ERM-gCam6f miRFP670nano-P2A-ERM-gCam6f (Homo sapiens) Wang Apr 10, 2024
217536 pAAV-TetON-Bmpr1A-ca constitutively active BMP receptor 1a (Homo sapiens) Scheiffele Apr 10, 2024
214926 plenti.CamKII.(synapto).cpsfGFP.miRFP670nano3 (synapto).cpsfGFP.miRFP670nano3 Ryan Apr 10, 2024
217537 pAAV-TetON-CD4 CD4 receptor (Homo sapiens) Scheiffele Apr 10, 2024
214701 pMSCV-IRES-GFP/CALR ins5 CALR ins5 (Homo sapiens) Komatsu Apr 10, 2024
214700 pMSCV-IRES-GFP/CALR del52 CALR (Homo sapiens) Komatsu Apr 10, 2024
214925 pAAV.CAG.(mito).cpSFGFP.HaloTag (mito).cpSFGFP.HaloTag Ryan Apr 10, 2024
214699 pMSCV-IRES-GFP/CALR wt CALR wt (Homo sapiens) Komatsu Apr 10, 2024
207581 pHAGE-UBC-MCP-mNeonGreen MS2 coat protein mNeonGreen fusion (Homo sapiens) Schmidt Apr 10, 2024
216760 pAAV/hSyn-SCLM SuperClomeleon (Other) Augustine Apr 10, 2024
216758 pAAV/CMV-SCLM SuperClomeleon followed by WPRE and human growth hormone polyA terminator (Other) Augustine Apr 10, 2024
213021 PB-LacI-eGFP LacI**-eGFP (Synthetic) Giorgetti Apr 10, 2024
207557 ATG9A sgRNA CACTGAATACCAGCGCCTAG (Homo sapiens) Schmidt Apr 10, 2024
207098 SHLD2 N-terminal sgRNA TTTTTATCAGAAATCATGAG (Homo sapiens) Schmidt Apr 10, 2024
216388 modRNAc1-VP64dCas9VP64-2A-MPH VP64dCas9VP64-2A-MPH Lian Apr 10, 2024
216389 modRNAc1-Cas9-2A-p53DD Cas9-2A-p53DD Lian Apr 10, 2024
216390 modRNAc1-Cas9-2A-puro Cas9-2A-puro Lian Apr 10, 2024
123628 actb2-SecAnxaV-mKate2-acry-EGFP AnnexinA5 (Synthetic) Parton Apr 10, 2024
198513-AAV1 pAAV_hSyn-PdCO-EGFP-WPRE (AAV1) Yizhar Apr 10, 2024
198513-AAV5 pAAV_hSyn-PdCO-EGFP-WPRE (AAV5) Yizhar Apr 10, 2024
198513-Vdna pAAV_hSyn-PdCO-EGFP-WPRE (Virus associated DNA) Yizhar Apr 10, 2024