pAAV-BRX-eGFP-NLS
(Plasmid
#217534)
-
PurposeAAV vector to drive the expression of eGFP under the control of the 4xBRE regulatory element of SMAD1 and miniXon splicing casette transcription factor in vivo
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 217534 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBMP reporter element and miniXon casette
-
SpeciesM. musculus (mouse)
-
Entrez GeneSmad1 (a.k.a. Mad1, Madh1, Madr1, Mlp1, MusMLP, dwf-A, mMad1)
- Promoter BMP Reporter Element
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (destroyed during cloning)
- 3′ cloning site AscI (destroyed during cloning)
- 5′ sequencing primer CTAGCAAAATAGGCTGTCC
- 3′ sequencing primer cgctatgtggatacgctgct (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byaddgene.org/67811/ plasmid was used to clone BRE element. https://www.addgene.org/174660/ plasmid was used to clone miniXon casette.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-BRX-eGFP-NLS was a gift from Peter Scheiffele (Addgene plasmid # 217534 ; http://n2t.net/addgene:217534 ; RRID:Addgene_217534) -
For your References section:
Control of neuronal excitation-inhibition balance by BMP-SMAD1 signaling. Okur Z, Schlauri N, Bitsikas V, Panopoulou M, Karmakar K, Schreiner D, Scheiffele P. bioRxiv 2023 10.1101/2023.03.11.532164