Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

hSirt3-RFP
(Plasmid #216806)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 216806 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pFCK(1.3)GW
  • Backbone size w/o insert (bp) 9239
  • Total vector size (bp) 11141
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Zeocin ; bleomycin and phleomycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Sirt3
  • Alt name
    sirtuin 3
  • Alt name
    NAD-dependent protein deacetylase sirtuin-3
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1902
  • GenBank ID
  • Entrez Gene
    SIRT3 (a.k.a. SIR2L3)
  • Promoter CamKII
  • Tag / Fusion Protein
    • mRFP1 (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site Age1 (not destroyed)
  • 5′ sequencing primer GAGGCTGTGAGCAGCCACAG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    hSirt3-RFP was a gift from Ghazaleh Ashrafi (Addgene plasmid # 216806 ; http://n2t.net/addgene:216806 ; RRID:Addgene_216806)
  • For your References section:

    Sirtuin3 ensures the metabolic plasticity of neurotransmission during glucose deprivation. Tiwari A, Hashemiaghdam A, Laramie MA, Maschi D, Haddad T, Stunault MI, Bergom C, Javaheri A, Klyachko V, Ashrafi G. J Cell Biol. 2024 Jan 1;223(1):e202305048. doi: 10.1083/jcb.202305048. Epub 2023 Nov 21. 10.1083/jcb.202305048 PubMed 37988067