pkk223_EcMutY
(Plasmid
#213110)
-
Purposepkk223 with E coli MutY insert
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 213110 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepkk223
- Backbone size w/o insert (bp) 4557
- Total vector size (bp) 5630
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameMutY (adenine glycosylase)
-
SpeciesEscherichia coli
-
Insert Size (bp)1051
-
Entrez GenemutY (a.k.a. b2961, ECK2956, micA)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gttttttgcgccgacatcataacggttc
- 3′ sequencing primer gcttctgcgttctgatttaatctgtatcaggctg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://www.biorxiv.org/content/10.1101/2023.04.05.535768v2 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pkk223_EcMutY was a gift from Martin Horvath (Addgene plasmid # 213110 ; http://n2t.net/addgene:213110 ; RRID:Addgene_213110) -
For your References section:
Metagenome mining and functional analysis reveal oxidized guanine DNA repair at the Lost City Hydrothermal Field. Utzman PH, Mays VP, Miller BC, Fairbanks MC, Brazelton WJ, Horvath MP. bioRxiv 2023.04.05.535768 10.1101/2023.04.05.535768