Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pkk223_EcMutY
(Plasmid #213110)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 213110 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pkk223
  • Backbone size w/o insert (bp) 4557
  • Total vector size (bp) 5630
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MutY (adenine glycosylase)
  • Species
    Escherichia coli
  • Insert Size (bp)
    1051
  • Entrez Gene
    mutY (a.k.a. b2961, ECK2956, micA)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer gttttttgcgccgacatcataacggttc
  • 3′ sequencing primer gcttctgcgttctgatttaatctgtatcaggctg
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pkk223_EcMutY was a gift from Martin Horvath (Addgene plasmid # 213110 ; http://n2t.net/addgene:213110 ; RRID:Addgene_213110)
  • For your References section:

    Metagenome mining and functional analysis reveal oxidized guanine DNA repair at the Lost City Hydrothermal Field. Utzman PH, Mays VP, Miller BC, Fairbanks MC, Brazelton WJ, Horvath MP. bioRxiv 2023.04.05.535768 10.1101/2023.04.05.535768