-
Plasmid#46920PurposeYeast CEN/ARS vector (Leu2) that contains dCas9 fused to NLS controlled by TDH3 promoterDepositorInsertdCas9
UseCRISPRTagsExpressionYeastMutationPromoterTDH3Available sinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pX601-mCherry
Plasmid#84039PurposeStaphylococcus aureus (SaCas9) conjugated with mCherryDepositorInsertSaCas9
UseAAV and CRISPRTagsNLS and T2A-mCherryExpressionMammalianMutationPromoterCMVAvailable sinceDec. 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDonor-tBFP-NLS-Neo (Universal)
Plasmid#80767PurposeUniversal donor vector for CRISPR/Cas9-mediated homology-independent knock-in system.DepositorInsertPITCh-gRNA#3 targeting sequence (GCATCGTACGCGTACGTGTT)
UseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceMarch 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
pTDH3-dCas9-Mxi1
Plasmid#46921PurposeYeast CEN/ARS vector (Leu2) that contains dCas9 fused to NLS and Mxi1 domain controlled by TDH3 promoterDepositorInsertdCas9-Mxi1
UseCRISPRTagsExpressionYeastMutationPromoterTDH3Available sinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgGFP-NT1
Plasmid#46914PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GFP (NT1)DepositorInsertsgGFP-NT1
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6sgbbBsmbI-puro-2A-Fluc
Plasmid#100277PurposeLentiviral vector for CRISPR mediated gene editing in cells while expressing Firefly Luciferase for in vivo imagingDepositorTypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMutationPromoterAvailable sinceOct. 26, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMB952:PB-CAG-PuroR-nGFP-FLEx-SaCas9-P2A-mCherry-WPRE
Plasmid#168107PurposePiggyBac transposon vector constitutively driving PuroR-eGFP and conditionally expressing S.aureus Cas9 and mCherryDepositorInsertCas9-P2A-mCherry
UseCRISPR and Cre/LoxTagsHAExpressionMutationPromoterCAGAvailable sinceMay 28, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CMV-dSa VP64 Neurog2
Plasmid#99695PurposeExpresses dSa Cas9 fused to gold standard VP64 activator domain and Sa sgRNA for Neurog2 promoter, vector allows for activation of mouse Neurog2, can be packaged and delivered as AAVDepositorArticleInsertdCas9 and gRNA targeting Neurog2 (gRNA: GGTATATAAGGGGTTTTAAG) (Neurog2 Mouse, Synthetic)
UseAAV and CRISPRTagsVP64ExpressionMutationdead Cas9PromoterAvailable sinceSept. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRN3P_T3_ABE8e_IVT
Plasmid#201676PurposePlasmid to be used as DNA template for in vitro RNA transcription of the ABE8e base editor (A to G) by T3 RNA polymerase. The plasmid contains optimised 5'UTR and 3'UTR to improve protein expression.DepositorInsertecTadA(8e)-nSpCas9
UseCRISPR; Vector for in-vitro transcriptionTagsExpressionMutationPromoterT3 promoterAvailable sinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBZ202-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Sa163RT-NLS-T2A-mCherry
Plasmid#170184PurposeExpression vector for a sgRNA against BFP and spCas9-Sa163 RT fusion protein linked to mCherry via a T2A peptide. Donor template An was inserted in the Retron Sa163 msr-msd region by SpeI and AvrII.DepositorInsertsSa163 RT
Retron Sa163 msr-msd
BFP-to-GFP conversion donor template An
UseCRISPRTagsNLSExpressionMammalianMutationPromoterCBh and hU6Available sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBZ210-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Ec86RT-NLS-T2A-mCherry
Plasmid#170185PurposeExpression vector for a sgRNA against BFP and spCas9-Ec86 RT fusion protein linked to mCherry via a T2A peptide. Donor template An was inserted in the Retron Ec86 msr-msd region by SpeI and AvrII.DepositorInsertsEc86 RT
Retron Ec86 msr-msd
BFP-to-GFP conversion donor template An
UseCRISPRTagsNLSExpressionMammalianMutationPromoterCBh and hU6Available sinceJan. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV-dCas9-BFP-KRAB
Plasmid#46911PurposeHuman expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS, tagBFP and a KRAB domainDepositorInsertdCas9-BFP-KRAB fusion
UseCRISPR and LentiviralTags2xNLS, BFP, HA, and KRAB domainExpressionMammalianMutationPromoterSFFVAvailable sinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRNA EF1Alpha-puro-T2A-BFP
Plasmid#60955PurposeParental vector for the CRISPRi/a libraries. Expresses an sgRNA from the U6 promoter and a puromycin resistance cassette and BFP from the EF1Alpha promoterDepositorInsertssgGFP-NT2
puro-T2A-BFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterAvailable sinceJan. 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pHR-SFFV-KRAB-dCas9-P2A-mCherry
Plasmid#60954Purpose2nd Generation Lentiviral vector. Expresses an N-terminal KRAB-dCas9 fusion protein and mCherryDepositorInsertKRAB-dCas9-P2A-mCherry fusion
UseCRISPR and LentiviralTags2x NLS, HA, KRAB domain, and mCherryExpressionMammalianMutationPromoterSFFVAvailable sinceJan. 5, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgRosa26-1_CBh-Cas9-T2A-BFP
Plasmid#64216PurposeExpression vector for a sgRNA against the mouse Rosa26 locus and Cas9 linked to BFP via a T2A peptideDepositorInsertsCas9
sgRNA targeting ROSA26-1
UseCRISPRTags3xFLAG, NLS, and T2A-BFPExpressionMammalianMutationPromoterCBh and U6Available sinceMay 19, 2015AvailabilityAcademic Institutions and Nonprofits only -
JG1211: CAG-human dLbCpf1(D832A)-NLS-3xHA-VPR
Plasmid#104567PurposeMammalian expression vector for catalytically inactive Cpf1 from Lachnospiraceae bacterium (dLbCpf1) fused to VPR activatorDepositorInserthuman codon optimized ‘dead’ Cpf1 fused to HSV VPR activation domain
UseCRISPRTagsNLS-3xHA-VPRExpressionMammalianMutationD832APromoterCAGAvailable sinceJan. 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFC902
Plasmid#106904PurposeThe vector has a U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA-Gly repeat; and a gene encoding cas9 controlled by Ptef1 and Ttef1DepositorInsertscas9
pyrG
U3 promoter and terminator controlled gene encoding a transcript containing the sgRNA flanked by a tRNA gly repeat
UseCRISPR; Fungal expressionTagsSV40 NLSExpressionBacterialMutationPromoterAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pMEL16
Plasmid#107922PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRTagsExpressionYeastMutationPromoterAvailable sinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pNICKclos2.0
Plasmid#73228PurposeGenome editing for gene xylR (cbei-2385) in clostridium beijerinckii NCIMB 8052DepositorInsertsCas9 nickase
sgRNA to xylR
UseE.coli - clostridium shuttle vectorTagsExpressionMutationD10APromoterPj23119 and PthlAvailable sinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only -
pNICKclos1.0
Plasmid#73639PurposeGenome editing for gene pyrE (CAC-002) in Clostridium acetobutylicum ATCC 824DepositorInsertsCas9 nickase
sGRNA to pyrE
UseE.coli-clostridium shuttle vectorTagsExpressionMutationD10APromoterj23119 and ptbAvailable sinceJune 17, 2016AvailabilityAcademic Institutions and Nonprofits only