-
PurposeHuman expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS, tagBFP and a KRAB domain
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 46911 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHR
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 9000
- Total vector size (bp) 14167
-
Vector typeMammalian Expression, Lentiviral, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namedCas9-BFP-KRAB fusion
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5172
- Promoter SFFV
-
Tags
/ Fusion Proteins
- HA (C terminal on insert)
- 2xNLS (C terminal on insert)
- BFP (C terminal on insert)
- KRAB domain (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer gcttcccgagctctataaaagag
- 3′ sequencing primer CCAGAGGTTGATTATCGATAAGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe Cas9 gene was a gift from Martin Jinek and Jennifer Doudna
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was used in the experiments requiring stable expression of KRAB-dCas9 fusion protein from Gilbert et al., 2014 "Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation." Cell 159(3):647-61 PubMed ID: 25307932
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-SFFV-dCas9-BFP-KRAB was a gift from Stanley Qi & Jonathan Weissman (Addgene plasmid # 46911 ; http://n2t.net/addgene:46911 ; RRID:Addgene_46911) -
For your References section:
CRISPR-Mediated Modular RNA-Guided Regulation of Transcription in Eukaryotes. Gilbert LA, Larson MH, Morsut L, Liu Z, Brar GA, Torres SE, Stern-Ginossar N, Brandman O, Whitehead EH, Doudna JA, Lim WA, Weissman JS, Qi LS. Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044. 10.1016/j.cell.2013.06.044 PubMed 23849981