-
Purpose2nd Generation Lentiviral vector. Expresses an N-terminal KRAB-dCas9 fusion protein and mCherry
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60954 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepHR
-
Backbone manufacturerAddgene
- Backbone size w/o insert (bp) 9000
- Total vector size (bp) 14247
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersmCherry
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKRAB-dCas9-P2A-mCherry fusion
-
SpeciesH. sapiens (human)
-
Insert Size (bp)5244
- Promoter SFFV
-
Tags
/ Fusion Proteins
- KRAB domain (N terminal on insert)
- HA (C terminal on insert)
- 2x NLS (C terminal on insert)
- mCherry
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer gcttcccgagctctataaaagag
- 3′ sequencing primer CCAGAGGTTGATTATCGATAAGC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe Cas9 gene was a gift from Martin Jinek and Jennifer Doudna
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid contains a different promoter compared to the inducible KRAB-dCas9-P2A-mCherry construct described in Figure 5A of the associated publication (Gilbert et al., 2014). To create an inducible version of KRAB-dCas9-P2A-mCherry, subclone the insert into a backbone with an inducible promoter, such as pTRE3G.
For stable expression of KRAB-dCas9 as described in Gilbert et al., 2014, please see pHR-SFFV-dCas9-BFP-KRAB (Addgene plasmid #46911).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHR-SFFV-KRAB-dCas9-P2A-mCherry was a gift from Jonathan Weissman (Addgene plasmid # 60954 ; http://n2t.net/addgene:60954 ; RRID:Addgene_60954) -
For your References section:
Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS. Cell. 2014 Oct 23;159(3):647-61. doi: 10.1016/j.cell.2014.09.029. Epub 2014 Oct 9. 10.1016/j.cell.2014.09.029 PubMed 25307932