169,296 results
-
Plasmid#34831DepositorInsertLAMP1 (LAMP1 Human)
UseTagsGSTGSTGSTGA linker, Kozak, and mGFPExpressionMammalianMutationPromoterCMVAvailable sinceMay 2, 2012AvailabilityAcademic Institutions and Nonprofits only -
pH2rU3_ForInd_Omicron_sinobiological_Spiked21_T7_CMV_ZsGT2APurR
Plasmid#204146PurposeLentivirus backbone with BA.1 spike under an inducible promoter and constitutive expressed zsGreen-T2A-PuR genesDepositorInsertsSARS-CoV-2 BA.1 variant spike
zsGreen-T2A-PuR
UseLentiviralTagsExpressionMammalianMutation21 amino acid cytoplasmic tail deletionPromoterCMV and TRE3GAvailable sinceAug. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ClpX
Plasmid#234733PurposeHuman-codon optimized E. coli ClpX in mammalian cellsDepositorInsertClpX
UseTagsExpressionMammalianMutationPromoterAvailable sinceApril 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianMutationPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available sinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pENN.AAV.hSyn.Cre.WPRE.hGH (AAV1)
Viral Prep#105553-AAV1PurposeReady-to-use AAV1 particles produced from pENN.AAV.hSyn.Cre.WPRE.hGH (#105553). In addition to the viral particles, you will also receive purified pENN.AAV.hSyn.Cre.WPRE.hGH plasmid DNA. hSyn-driven Cre expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB-gDA3m (AAV1)
Viral Prep#208698-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-GRAB-gDA3m (#208698). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB-gDA3m plasmid DNA. Syn-driven expression of the genetically-encoded fluorescent dopamine (DA) sensor GRAB_gDA3m in neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-Coff/Fon-mCherry (AAV8)
Viral Prep#137134-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-Ef1a-Coff/Fon-mCherry (#137134). In addition to the viral particles, you will also receive purified pAAV-Ef1a-Coff/Fon-mCherry plasmid DNA. EF1a-driven, Flp-dependent expression of mCherry (inhibited in presence of Cre). These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Flp-dependent)Available sinceFeb. 23, 2021AvailabilityAcademic Institutions and Nonprofits only -
Flag-Gsdmd
Plasmid#80950PurposeExpresses Gsdmd in mammalian cellsDepositorInsertGsdmd (Gsdmd Mouse)
UseTagsFlagExpressionMammalianMutationPromoterAvailable sinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSynapsin1-FLEx-axon-GCaMP6s (AAV5)
Viral Prep#112010-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-hSynapsin1-FLEx-axon-GCaMP6s (#112010). In addition to the viral particles, you will also receive purified pAAV-hSynapsin1-FLEx-axon-GCaMP6s plasmid DNA. Synapsin-driven, cre-dependent axon targeted GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceDec. 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCS2+HyPer7-NLS
Plasmid#136468PurposeMammalian expression of nucleus targeted ultrasensitive hydrogen peroxide indicator HyPer7 for optical imagingDepositorInsertHyPer7
UseTagsTriple nuclear localization signal of SV40 (simia…ExpressionMammalianMutationPromoterCMV, SP6Available sinceAug. 18, 2020AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (AAV5)
Viral Prep#100835-AAV5PurposeReady-to-use AAV5 particles produced from pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 (#100835). In addition to the viral particles, you will also receive purified pAAV.CAG.Flex.GCaMP6f.WPRE.SV40 plasmid DNA. CAG-driven, Cre-dependent GCaMP6f calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsNoneAvailable sinceMay 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pET His6 GST TEV LIC cloning vector (1G)
Plasmid#29655DepositorTypeEmpty backboneUseTags6xHis, GST, and TEV cleavage siteExpressionBacterialMutationPromoterT7-lacO (lactose/IPTG inducible)Available sinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCMV delta R8.2
Plasmid#12263PurposeFirst-generation packaging plasmid. This plasmid contains HIV accessory genes. Please reach out to your biosafety officer for guidance.DepositorInsertHIV-1 GAG/POL, Tat and Rev
UseLentiviral; PackagingTagsExpressionMammalianMutationPromoterAvailable sinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCMV delta R8.2
Plasmid#12263PurposeFirst-generation packaging plasmid. This plasmid contains HIV accessory genes. Please reach out to your biosafety officer for guidance.DepositorInsertHIV-1 GAG/POL, Tat and Rev
UseLentiviral; PackagingTagsExpressionMammalianMutationPromoterAvailable sinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pCMV_Cas9–superNLS
Plasmid#232430PurposeExpression plasmid for the SpCas9 nuclease with superNLSDepositorInsertCas9–superNLS
UseCRISPRTagsExpressionMammalianMutationPromoterCMVAvailable sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCMV-AID-PcrA M6-UGI-T2A-mTagBFP2
Plasmid#221225PurposeExpress HACE Editor as a fusion of AID cytidine deaminase and an optimized PcrA M6 helicase with mTagBFP2 reporterDepositorInsertAID-PcrA M6-UGI-T2A-mTagBFP2
UseTagsExpressionMammalianMutationPromoterAvailable sinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV2/rh10
Plasmid#112866PurposeAAV packaging plasmid expressing Rep/Cap genesDepositorInsertRep2/Cap-rh10
UseAAVTagsExpressionMutationPromoterTruncated P5Available sinceSept. 19, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GCaMP6f (AAV9)
Viral Prep#135632-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-S5E2-GCaMP6f (#135632). In addition to the viral particles, you will also receive purified pAAV-S5E2-GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the E2 regulatory element. These AAV preparations are suitable purity for injection into animals.DepositorPromoterTagsNoneAvailable sinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM4D(Gi)-mCherry (AAV9)
Viral Prep#44362-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-DIO-hM4D(Gi)-mCherry (#44362). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM4D(Gi)-mCherry plasmid DNA. hSyn-driven, Cre-dependent, hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available sinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCAG-mTagBFP2
Plasmid#122373PurposeExpresses mTagBFP2 in mammalian cellsDepositorInsertmTagBFP2
UseTagsExpressionMammalianMutationPromoterAvailable sinceJune 30, 2020AvailabilityAcademic Institutions and Nonprofits only