229,386 results
-
Plasmid#54759PurposeLocalization: C1 Cloning Vector, Excitation: 488, Emission: 507DepositorHas ServiceCloning Grade DNATypeEmpty backboneTagsmEGFPExpressionMammalianAvailable SinceJune 20, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits
-
mEGFP-C1
Plasmid#54759PurposeLocalization: C1 Cloning Vector, Excitation: 488, Emission: 507DepositorHas ServiceCloning Grade DNATypeEmpty backboneTagsmEGFPExpressionMammalianAvailable SinceJune 20, 2014AvailabilityIndustry, Academic Institutions, and Nonprofits -
pLV_3xFLAG-ATP6V0A3-mScarlet
Plasmid#228867PurposeStable expression of V-ATPase subunit ATP6V0A3 with N-terminal 3xFLAG and C-terminal mScarletDepositorAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV_3XHA-ATP6V1B2-mNeonGreen
Plasmid#228865PurposeStable expression of V-ATPase subunit ATP6V1B2 with N-terminal 3xHA and C-terminal mNeonGreenDepositorAvailable SinceNov. 26, 2024AvailabilityAcademic Institutions and Nonprofits only -
pT3-EF1A-mTert
Plasmid#162555PurposeOverexpression of TertDepositorAvailable SinceFeb. 17, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCW57-GFP-2A-MCS
Plasmid#71783PurposeAll-in-one doxycycline inducible lentiviral vector for expression of one gene in combination with turbo GFP using the P2A self-cleaving peptide.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Doxycycline inducible; p2a self cleav…ExpressionMammalianAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCW57-GFP-2A-MCS
Plasmid#71783PurposeAll-in-one doxycycline inducible lentiviral vector for expression of one gene in combination with turbo GFP using the P2A self-cleaving peptide.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Doxycycline inducible; p2a self cleav…ExpressionMammalianAvailable SinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-ExRai-CKAR2
Plasmid#236096PurposeEnhanced excitation-ratiometric biosensor for monitoring Protein Kinase C activity in living cells.DepositorInsertExRai-CKAR2
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tagExpressionMammalianPromoterCMVAvailable SinceMay 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
lentiMPH v2
Plasmid#89308Purposelenti vector encoding the MS2-P65-HSF1 activator helper complex with a 2A Hygro resistance marker (EF1a-MS2-p65-HSF1-2A-Hygro-WPRE). This version has a higher virus titer.DepositorInsertMS2-P65-HSF1_2A_Hygro (RELA Human, Synthetic)
UseLentiviralExpressionMammalianMutationN55K in MS2PromoterEF1aAvailable SinceMarch 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
pNL [NlucP/CRE/Hygro] Vector
Plasmid#236829PurposeExpress CRE response element in luciferase reporter assayDepositorHas ServiceDNAInsertCRE
UseLuciferaseTagsNanoLuc (R)MutationNonePromoterminPAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-hSyn-DIO-mCherry (AAV2)
Viral Prep#50459-AAV2PurposeReady-to-use AAV2 particles produced from pAAV-hSyn-DIO-mCherry (#50459). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-mCherry plasmid DNA. hSyn-driven, Cre-dependent mCherry-expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceNov. 29, 2016AvailabilityAcademic Institutions and Nonprofits only -
pRK5_mCherry_P2AT2A_GFP-nb-2xKS
Plasmid#238236PurposeFor overexpression of mCherry_P2AT2A_GFP-nb-2xKSDepositorInsertmCherry_P2AT2A_GFP-nb-2xKS
ExpressionMammalianAvailable SinceJune 3, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Syn-ChrimsonR-tdT (AAV9)
Viral Prep#59171-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-Syn-ChrimsonR-tdT (#59171). In addition to the viral particles, you will also receive purified pAAV-Syn-ChrimsonR-tdT plasmid DNA. Syn-driven ChrimsonR-tdTomato expression for optogenetic neural activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagstdTomatoAvailable SinceFeb. 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-EKAR4
Plasmid#174437PurposeImproved cyan/yellow FRET-based ERK kinase activity reporter.DepositorInsertEKAR4
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tagExpressionMammalianPromoterCMVAvailable SinceSept. 22, 2021AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-pmEMBer
Plasmid#174441PurposePlasma membrane-targeted ERK monobody binder for local inhibition of ERK activity in live cells.DepositorInsertpmEMBer
Tags6xHIS - T7 tag (gene 10 leader) - Xpress (TM) tag…ExpressionMammalianPromoterCMVAvailable SinceAug. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM4D(Gi)-mCherry (AAV9)
Viral Prep#50475-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-hM4D(Gi)-mCherry (#50475). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM4D(Gi)-mCherry plasmid DNA. hSyn-driven hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-mCherry (AAV9)
Viral Prep#114472-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-mCherry (#114472). In addition to the viral particles, you will also receive purified pAAV-hSyn-mCherry plasmid DNA. Synapsin-driven mCherry control vector. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pBOB-EF1-FastFUCCI-Puro
Plasmid#86849Purpose3rd generation lentiviral vector encoding FUCCI reporters for cell cycle analysis and puro for selectionDepositorInsertsmKO2-hCDT1(30-120)
mAG-hGEM(1-110)
pac (puromycin N-acetyl-transferase)
UseLentiviralExpressionMammalianPromoterEF1 and PGKAvailable SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBOB-EF1-FastFUCCI-Puro
Plasmid#86849Purpose3rd generation lentiviral vector encoding FUCCI reporters for cell cycle analysis and puro for selectionDepositorInsertsmKO2-hCDT1(30-120)
mAG-hGEM(1-110)
pac (puromycin N-acetyl-transferase)
UseLentiviralExpressionMammalianPromoterEF1 and PGKAvailable SinceNov. 14, 2017AvailabilityAcademic Institutions and Nonprofits only -
FUGW
Plasmid#14883Purpose3rd gen lentiviral plasmid with hUbC-driven EGFP; can be used for cDNA expresionDepositorInsertflap-Ub promoter-GFP-WRE
UseLentiviralExpressionMammalianAvailable SinceMay 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
FUGW
Plasmid#14883Purpose3rd gen lentiviral plasmid with hUbC-driven EGFP; can be used for cDNA expresionDepositorInsertflap-Ub promoter-GFP-WRE
UseLentiviralExpressionMammalianAvailable SinceMay 1, 2007AvailabilityAcademic Institutions and Nonprofits only -
pLX304
Plasmid#25890Purpose3rd generation lentiviral Gateway destination vector. Blasticidin selection, V5 tag.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Gateway destination vectorTagsV5ExpressionMammalianAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLX304
Plasmid#25890Purpose3rd generation lentiviral Gateway destination vector. Blasticidin selection, V5 tag.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral; Gateway destination vectorTagsV5ExpressionMammalianAvailable SinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKIIa-hChR2(H134R)-EYFP (AAV5)
Viral Prep#26969-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-CaMKIIa-hChR2(H134R)-EYFP (#26969). In addition to the viral particles, you will also receive purified pAAV-CaMKIIa-hChR2(H134R)-EYFP plasmid DNA. CaMKIIa-driven, humanized channelrhodopsin H134R mutant fused to EYFP for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsEYFPAvailable SinceMarch 7, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dR8.2 dvpr
Plasmid#8455Purpose2nd* generation lentiviral packaging plasmid. (*See comments section.) Can be used with 2nd and 3rd generation transfer vectors. Use in conjunction with an envelope plasmid such as pCMV-VSV-G.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 20, 2005AvailabilityAcademic Institutions and Nonprofits only -
pCMV-dR8.2 dvpr
Plasmid#8455Purpose2nd* generation lentiviral packaging plasmid. (*See comments section.) Can be used with 2nd and 3rd generation transfer vectors. Use in conjunction with an envelope plasmid such as pCMV-VSV-G.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralExpressionMammalianAvailable SinceJune 20, 2005AvailabilityAcademic Institutions and Nonprofits only -
v5 ABE-eVLP
Plasmid#228467PurposeExpresses MMLVgag(C507V)–ABE8e for producing v5 ABE-eVLPsDepositorInsertMMLVgag(C507V)–ABE8e
TagsFLAGExpressionMammalianMutationMMLVgag(C507V)PromoterCMVAvailable SinceNov. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Ubiquitin-K63
Plasmid#17606PurposeMammalian expression of HA tagged ubiquitin with K63 only, other lysines mutated to argininesDepositorInsertUbiquitin C (UBC Human)
TagsHAExpressionMammalianMutationK63 only, other lysines mutated to arginines. Enh…Available SinceMarch 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Ubiquitin-K63
Plasmid#17606PurposeMammalian expression of HA tagged ubiquitin with K63 only, other lysines mutated to argininesDepositorInsertUbiquitin C (UBC Human)
TagsHAExpressionMammalianMutationK63 only, other lysines mutated to arginines. Enh…Available SinceMarch 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP7s-WPRE (AAV1)
Viral Prep#104487-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-jGCaMP7s-WPRE (#104487). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP7s-WPRE plasmid DNA. Synapsin-driven GCaMP7s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceJuly 11, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-mitoGFP
Plasmid#44385DepositorInsertmitoGFP (COX8A Human)
UseLentiviralTagsCox8 targeting sequence and GFPExpressionMammalianPromoterCMVAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLV-mitoGFP
Plasmid#44385DepositorInsertmitoGFP (COX8A Human)
UseLentiviralTagsCox8 targeting sequence and GFPExpressionMammalianPromoterCMVAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
pV238-vPE
Plasmid#225258PurposeMammalian expression of vPEDepositorInsertvPE
UseCRISPRExpressionMammalianMutationR221K K848A H982A N1317RPromoterCMVAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pUltra
Plasmid#24129Purpose3rd generation Lentiviral vector for bi-cistronic expression of EGFP and the gene of interestDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianAvailable SinceFeb. 26, 2010AvailabilityAcademic Institutions and Nonprofits only -
pUltra
Plasmid#24129Purpose3rd generation Lentiviral vector for bi-cistronic expression of EGFP and the gene of interestDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviralTagsEGFPExpressionMammalianAvailable SinceFeb. 26, 2010AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Ubiquitin-K48
Plasmid#17605PurposeMammalian expression of HA tagged ubiquitin with only K48, other lysines mutated to argininesDepositorInsertUbiquitin C (UBC Human)
TagsHAExpressionMammalianMutationK48 only, other lysines mutated to arginines. Enh…Available SinceMarch 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
pRK5-HA-Ubiquitin-K48
Plasmid#17605PurposeMammalian expression of HA tagged ubiquitin with only K48, other lysines mutated to argininesDepositorInsertUbiquitin C (UBC Human)
TagsHAExpressionMammalianMutationK48 only, other lysines mutated to arginines. Enh…Available SinceMarch 31, 2008AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-PR rep/cap
Plasmid#197565Purposeencodes AAV-PR capsid that transduces pericytes and smooth muscle cells in mice after systemic deliveryDepositorInsertsAAV Rep genes
AAV9 VP1 Cap gene with PR insert
UseAAVMutationcontains 7mer insert PRPPSTH between amino acids …Available SinceJune 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (AAV9)
Viral Prep#20298-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA (#20298). In addition to the viral particles, you will also receive purified pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA plasmid DNA. EF1a-driven, Cre-dependent, humanized channelrhodopsin H134R mutant fused to EYFP, for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsEYFP (Cre-dependent)Available SinceMarch 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKC107_pLenti_TetON_sfGFP_INT
Plasmid#242109PurposeTet- or Dox-inducible expression of sfGFP fused to INT (human PARP4 fragment)DepositorInsertPARP4 fragment
UseLentiviralTagssfGFPMutationPARP4 aa 1562-1724PromoterTRE3GAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-GFP (AAV9)
Viral Prep#37825-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-CAG-GFP (#37825). In addition to the viral particles, you will also receive purified pAAV-CAG-GFP plasmid DNA. CAG-driven GFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagsGFPAvailable SinceMay 28, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (AAV9)
Viral Prep#105545-AAV9PurposeReady-to-use AAV9 particles produced from pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 (#105545). In addition to the viral particles, you will also receive purified pAAV.CMV.HI.eGFP-Cre.WPRE.SV40 plasmid DNA. CMV-driven EGFP-Cre expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterHITagsEGFPAvailable SinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
hnRNPA1-FLAG-IRES-eGFP
Plasmid#234619PurposeMammalian expression of full-length hnRNPA1 with C-terminal FLAG tag co-expressing with eGFP via IRES sequenceDepositorInserthnRNPA1 (HNRNPA1 Human)
TagsFLAGExpressionMammalianMutationC-terminal FLAG tag, co-expressing with eGFP via …PromoterCMVAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1187 VSVGmut
Plasmid#201913PurposeExpresses a VSV-G variant (K47Q R354A) defective for LDL-R receptor binding (CAG promoter)DepositorInsertVSV-G (K47Q, R354A)
ExpressionMammalianMutationK47Q, R354APromoterCAGAvailable SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pX330 p53
Plasmid#59910PurposepX330 backbone expressing sgRNA targeting p53 to edit mouse p53. Expresses Cas9 from CBh promoterDepositorAvailable SinceMarch 16, 2015AvailabilityAcademic Institutions and Nonprofits only -
pTn Donor
Plasmid#236211PurposeArabinose-inducible Tn5 InducTn-seq plasmidDepositorInsertNone
ExpressionBacterialAvailable SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHCMV-EcoEnv
Plasmid#15802DepositorInsertMLV env (ecotropic)
ExpressionMammalianAvailable SinceMarch 21, 2008AvailabilityAcademic Institutions and Nonprofits only -
pHCMV-EcoEnv
Plasmid#15802DepositorInsertMLV env (ecotropic)
ExpressionMammalianAvailable SinceMarch 21, 2008AvailabilityAcademic Institutions and Nonprofits only