pJRH-1187 VSVGmut
(Plasmid
#201913)
-
PurposeExpresses a VSV-G variant (K47Q R354A) defective for LDL-R receptor binding (CAG promoter)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 201913 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Currently unavailable outside the U.S.
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
- Total vector size (bp) 6264
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameVSV-G (K47Q, R354A)
-
SpeciesVesicular stomatitis virus
-
Insert Size (bp)1533
-
MutationK47Q, R354A
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CTCTAGAGCCTCTGCTAACC
- 3′ sequencing primer GCCAGAAGTCAGATGCTCAAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJRH-1187 VSVGmut was a gift from Jennifer Doudna (Addgene plasmid # 201913 ; http://n2t.net/addgene:201913 ; RRID:Addgene_201913) -
For your References section:
In vivo human T cell engineering with enveloped delivery vehicles. Hamilton JR, Chen E, Perez BS, Sandoval Espinoza CR, Kang MH, Trinidad M, Ngo W, Doudna JA. Nat Biotechnol. 2024 Jan 11. doi: 10.1038/s41587-023-02085-z. 10.1038/s41587-023-02085-z PubMed 38212493
