Skip to main content
Addgene

Structure-Mediated RNA Decay by UPF1 and G3BP1.

Fischer JW, Busa VF, Shao Y, Leung AKL
Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi: 10.1016/j.molcel.2020.01.021. Epub 2020 Feb 3. (Link opens in a new window) PubMed (Link opens in a new window) Article

Plasmids from Article

ID Plasmid Purpose
135994pci-EGFP-UPF1-WTWT UPF1 inserted with GFP tagged on the N-terminus used to stably integrate into cells
135995pci-EGFP-UPF1-R615AR615A UPF1 inserted with GFP tagged on the N-terminus used to stably integrate into cells
135996pci-EGFP-UPF1-DEAADEAA UPF1 inserted with GFP tagged on the N-terminus used to stably integrate into cells
135997pEGFP-C1-G3BP1-WTWT G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cells
135998pEGFP-C1-G3BP1-S149AS149A G3BP1 inserted with GFP tagged on the N-terminus used to stably integrate into cells
135999pEGFP-C1-G3BP1-DeltaRBPG3BP1 with RNA binding domains deleted inserted with GFP tagged on the N-terminus
136000pcDNA5 FRT-TO-EGFP-UPF1-WTDOX-inducible WT UPF1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System
136001pcDNA5 FRT-TO-EGFP-UPF1-R615ADOX-inducible R615A UPF1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System
136002pcDNA5 FRT-TO-EGFP-UPF1-DEAADOX-inducible DEAA UPF1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System
136003pcDNA5 FRT TO-EGFP-G3BP1-WTDOX-inducible WT G3BP1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System
136004pcDNA5 FRT TO-EGFP-G3BP1-S149ADOX-inducible S149A G3BP1 inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System
136005pcDNA5 FRT TO-EGFP-G3BP1-DeltaRBPDOX-inducible G3BP1 with RNA binding domains deleted inserted with GFP tagged on the N-terminus and used with the Flp-In T-Rex System
136006pCI-neo-lambdaN-UPF1-WTWT UPF1 inserted with lambdaN tagged on the N-terminus to use with the Tethering Assay (BoxB)
136007pCI-neo-lambdaN-UPF1-DEAADEAA UPF1 inserted with lambdaN tagged on the N-terminus to use with the Tethering Assay (BoxB)
136008pCI-neo-His-MS2BP-G3BP1-WTWT G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)
136009pCI-neo-His-MS2BP-G3BP1-S149AS149A G3BP1 inserted with MS2BP tagged on the N-terminus to use with the Tethering Assay (MS2)
136010psi-CHECK3psi-CHECK2 plasmid modified so both Renilla and Firefly luciferase contain introns
136011psi-CHECK3-3xBoxB-MS23 repeats of BoxB and MS2 hairpins inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid for the Tethering assay
136012psiCHECK3-EIF3BEIF3B 3'UTR (NM_001037283.1) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136013psiCHECK3-SDHAF3SDHAF3 3'UTR (NM_020186.2) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136014psiCHECK3-TMED3TMED3 3'UTR (NM_007364.3) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136015psiCHECK3-ZC3H15ZC3H15 3'UTR (NM_018471.2) inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136016psiCHECK3-EIF3B-Reverse-ComplementThe Reverse Complement of EIF3B 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136018psiCHECK3-TMED3-Reverse-ComplementThe Reverse Complement of TMED3 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136019psiCHECK3-ZC3H15-Reverse-ComplementThe Reverse Complement of ZC3H15 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136020psiCHECK3-EIF3B-1-147EIF3B (1-147) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136021psiCHECK3-EIF3B-148-464EIF3B (148-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136022psiCHECK3-EIF3B-465-552EIF3B (465-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136023psiCHECK3-EIF3B-1-464EIF3B (1-464) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136024psiCHECK3-EIF3B-148-552EIF3B (148-552) 3'UTR fragment inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136025psiCHECK3-UnstructuredArtificial Unstructured 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136026psiCHECK3-EIF3B-UnstructuredEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136027psiCHECK3-Unstructured-EIF3BEIF3B 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136028psiCHECK3-EIF3B-465-552-UnstructuredEIF3B (465-552) 3'UTR with the Artificial Unstructured 3'UTR fused downstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136029psiCHECK3-Unstructured-EIF3B-465-552EIF3B (465-552) 3'UTR with the Artificial Unstructured 3'UTR fused upstream inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136030psiCHECK3-EIF3B-88nt-Delta-HairpinEIF3B (465-552) 3'UTR with the main hairpin deleted inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136031psiCHECK3-EIF3B-88nt-1st-HairpinEIF3B (465-552) 3'UTR with only the main hairpin inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136032psiCHECK3-EIF3B-88nt-Disrupted-HairpinEIF3B (465-552) 3'UTR with the main hairpin mutated inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136033psiCHECK3-EIF3B-88nt-Restored-HairpinEIF3B (465-552) 3'UTR with the main hairpin restored inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136034psiCHECK3-EIF3B-88nt-A:U-HairpinEIF3B (465-552) 3'UTR with the main hairpin mutated to A and U nucleotides only inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid
136035PLKO.1-ScrambledScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)
136036PLKO.1-UPF1-3'UTRUPF1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (TTATTACCCAGAATAAGATGC)
136037PLKO.1-UPF1-CDSUPF1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (AAGACACCTATTACACGAAGG)
136038PLKO.1-G3BP1-3'UTRG3BP1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTGTAAGAAATACAGGATT)
136039PLKO.1-G3BP1-CDSG3BP1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGGGAATTTGTGAGACAGTAT)
136040PLKO.1-UPF2-CDSUPF2 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCGTTATGTTTGGTGGAAGAA)
136041PLKO.1-UPF2-3'UTRUPF2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CGCGAGGGTTAATCTTCTCTT)
136042PLKO.1-UPF3A-3'UTRUPF3A shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GACGTAGAAACACGCAGAAAC)
136043PLKO.1-UPF3A-CDSUPF3A shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GCAGAAACCATTCTAAAGAAA)
136044PLKO.1-UPF3B-3'UTRUPF3B shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CAGGGCAAAGAATAGAGAGAA)
136045PLKO.1-UPF3B-CDSUPF3B shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GAAGCCTTGTTCCGATCTAAT)
136046PLKO.1-SMG6-CDS-1SMG6 shRNA (Targeting CDS #1) inserted into the PLKO.1 plasmid (AACTTGTAAGTAACCTGCAGC)
136047PLKO.1-SMG6-CDS-2SMG6 shRNA (Targeting CDS #2) inserted into the PLKO.1 plasmid (AAGGAGTTCCAGGTGTTACTG)
136048PLKO.1-STAU1-CDSSTAU1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CGAGTAAAGCCTAGAATCAAA)
136049PLKO.1-STAU1-3'UTRSTAU1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (CCATCACCACTGCTTTCTCTT)
136050PLKO.1-STAU2-CDSSTAU2 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (GATATGAACCAACCTTCAA)
136051PLKO.1-STAU2-3'UTRSTAU2 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCAGGTAGTTGTTAGTGTTT)
136052PLKO.1-REG1-3'UTRREG1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (ATTGTATCTCTGTAGTTTAAG)
136053PLKO.1-REG1-CDSREG1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (TATGGGATCAAGTGCCGATTC)
136054PLKO.1-CAPRIN1-CDSCAPRIN1 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTCAGCAGAACACTGGATTT)
136055PLKO.1-CAPRIN1-3'UTRCAPRIN1 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCACGTTAGTGTCACAAATT)
136056PLKO.1-USP10-3'UTRUSP10 shRNA (Targeting 3'UTR) inserted into the PLKO.1 plasmid (GCCTCTCTTTAGTGGCTCTTT)
136057PLKO.1-USP10-CDSUSP10 shRNA (Targeting CDS) inserted into the PLKO.1 plasmid (CCTATGTGGAAACTAAGTATT)
136058pSpCas9(BB)-2A-GFP-G3BP1(1)G3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)
136059pSpCas9(BB)-2A-GFP-G3BP1(2)G3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)
136060pSpCas9(BB)-2A-GFP-G3BP2(1)G3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)
136061pSpCas9(BB)-2A-GFP-G3BP2(2)G3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)

Antibodies from Article