pET-21a(+)-BMTU UDG-6xHis
(Plasmid #172197)

• Purpose: expresses His-tagged uracil-DNA-glycosylase enzyme from marine bacterium BMTU 3346 for the purpose of cross contamination prevention in nucleic acid amplification reactions
• Depositing Lab: Andrea Pauli
• Publication: Robust and inexpensive molecular diagnostic s with lyophilized open access RT - LAMP (unpublished)

Backbone

• Vector backbone: pET-21(+)
• Backbone manufacturer: EMD Bioscience
• Backbone size w/o insert (bp): 5443
• Total vector size (bp): 5996
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: BMTU UDG
• Alt name: BMTU 3346 UDG
• Alt name: UNG
• Alt name: uracil-DNA-glycosylase
• Species: marine bacterium BMTU 3346 UDG
• Insert Size (bp): 745
• Promoter: T7
• Tag / Fusion Protein:
  • 6xHis tag (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

E. coli codon-optimised variant of BMTU 3346 UDG gene originally published in:

Jaeger, S., Schmuck, R., & Sobek, H. (2000). Molecular cloning, sequency, and expression of the heat-labile uracil-DNA glycosylase from a marine psychrophilic bacterium, strain BMTU3346. Extremophiles : life under extreme conditions, 4(2), 115–122. https://doi.org/10.1007/s007920050145