...Recommended Working Concentration Ampicillin 100 mg/mL 100 µg/mL Carbenicillin* 100 mg/mL 100 µg/mL Chloramphenicol...Tetracycline 10 mg/mL 10 µg/mL *Note: Carbenicillin can be used in place of ampicillin. Preparing Antibiotics Create...to make 100 mL of LB/ampicillin growth media, add 100 μL of a 100 mg/mL ampicillin stock (1000X stock) ...consists of Adenine, Cytosine, Guanine and Uracil (U). Uracil replaces thymine in RNA molecules. Every ...., a gene whose product confers resistance to ampicillin) is included in the plasmid. These bacteria are... are then grown in the presence of ampicillin. Under these conditions, there is a selective pressure to...common plasmid types: Cloning Plasmids - Used to facilitate the cloning of DNA fragments. Cloning vectors...

...by long terminal repeat (LTR) sequences, which facilitate integration of the transfer plasmid sequences...target species. Although chromatin availability facilitates integration, it does not explain the lentiviral...pre-integration complex to transcriptional units and facilitates integration. LEDGF/p75 binding sites are enriched...unspliced and partially spliced transcripts to facilitate nuclear export. Tat in trans Second generation...

...Kb. Constructs contain left and right arms to facilitate homologous recombination of the transgene into...have matching left and right homology arms which facilitate homologous recombination of the transgene into...

...by long terminal repeat (LTR) sequences, which facilitate integration of the transfer plasmid sequences...

...Rep and Cap shown in the figure on the right facilitates the viral pseudotyping discussed below. Overview...

...forward primer Amp-R ATAATACCGCGCCACATAGC 5' end of ampicillin resistance gene, reverse primer AUG1 Forward ...

...efficient mRNA delivery into the mouse zygotes and facilitates CRISPR/Cas9-based genome editing. Scientific ...

...RHJ, DiBerto JF, et al. (2015). A New DREADD Facilitates the Multiplexed Chemogenetic Interrogation of...