We narrowed to 89 results for: tes
-
TypeCollection...carry in the target cell. These vectors allow you to test the function of your gene of interest in a controlled...zebrafish insulin promoter vector with multiple cloning sites Browse our full Fluorescent Protein...inserted into this firefly luciferase reporter to test for their effects on protein production AAV-GfaABC1D-MCS...
-
Validated gRNA Sequences
TypeCollection... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes... -
Institute for Protein Innovation
TypeCollection...accessible toolset for scientists worldwide. Figure courtesy of IPI Browse Glypican Antibodies ID Recombinant...blocking ligand binding and receptor function Figure courtesy of IPI Browse Integrin Antibodies ID Recombinant... -
CRISPR Plasmids - Cascade-Cas3
TypeCollection...CRISPR family. After nicking the target DNA, Cas3 initiates single-strand DNA degradation. This degradation...targeted strand non-specifically along the way. Cas3 initiates a final double-strand break, either due to a boundary... -
Brzezinski Lab CRISPR Collection
TypeCollection...Brzezinski Lab CRISPR Collection The Brzezinski lab investigates gene regulation in the context of the developing...fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide expressing plasmids dCas9-KRAB-MeCP2... -
Chemogenetics Plasmids
TypeCollection...oxidizes its substrate (luciferin), it generates light that activates the opsin to either excite or inhibit... -
E11 Bio PRISM Collection
TypeCollection...proteins to label and detect multiple injection sites in the same tissue, as well as barcoding with specific...Stochastic infection of pooled AAVs delivered in vivo generates unique combinations of protein bits. B) Multiplex... -
Synthetic Biology - Overview
TypeCollection...contains pre-assembled genetic circuits such as logic gates and higher level gene networks. Sensing and Signaling...Quorum Sensing Ellis Lab GeneGuard Endy Lab Logic Gates , BIOFAB Promoter/BCD Kit , and pOSIP Plasmid Kit... -
CRISPR Plasmids - Yeast
TypeCollection...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ... transcription factor and other protein binding sites. ID Plasmid Gene/Insert Promoter Selectable Marker... -
Zinc Finger Consortium: Zinc Finger Arrays
TypeCollection... length of the spacer sequence between the half-sites (see Nuclease Expression Vectors for more details...two-hybrid reporter system but have NOT yet been tested for activity as ZFNs in zebrafish. Target Gene ... -
Microbiology Resources
TypeCollection...microbial fields, including bacteria, viruses, parasites such as protozoa, and fungi. Find plasmids below...microbiology resources. The plasmids Addgene distributes cannot be used to reconstitute self-replicating... -
Worm Expression Resources
TypeCollection...set of plasmids for building homologous repair templates that incorporate a self-excising drug selection...Center (CGC) - The CGC collects, maintains, and distributes stocks of C. elegans. Silencing Genomes - Cold... -
CRISPR Plasmids - Bacteria
TypeCollection...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ... transcription factor and other protein binding sites. ID Plasmid Gene/Insert Promoter PI Publication ... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...transfer vectors you can find reporter plasmids to test whether or not you've efficiently generated infectious...recombinases to remove genes flanked by either loxP or FRT sites respectively, and empty vectors to express your ... -
Neurodegeneration Research Collection
TypeCollection...Boender et al. Sci Adv. 2023 Jun 2. Use Cas9 in astrocytes. Endo et al Science. 2022 Nov 4. Base edit human...Alzheimer’s disease and related disorders. The site curates information on useful resources such as: Antibodies... -
Rett Syndrome
TypeCollection...window) PMID: 10508514 2007 - Adrian Bird's lab demonstrates that Rett syndrome symptoms are reversible in...Joost Gribnau Xist 2lox/2lox Conditional Xist, Lox sites flanking exon 1,2,3 C57BL/6 Mouse line with conditional... -
Luciferase Plasmid Collection
TypeCollection...untranslated regions, or shRNA or CRISPR target sites can be inserted into a luciferase-containing plasmid..., and different luciferases require different substrates and detection wavelengths. Firefly luciferase... -
Retrograde AAV viral preps
TypeCollection...staining, in vitro and (when possible) in vivo testing, and full sequencing of the final viral vector ...vector preparation. In some cases, in vivo testing of these viral preparations was performed by the Karpova... -
Tetracycline Inducible Expression
TypeCollection... and reversible control of gene expression in eukaryotes. To avoid secondary effects from repurposing ...tetracycline, tTA binds to the TRE and its VP16 domain promotes gene expression. In the presence of tetracycline... -
Neuroscience
TypeCollection... represent the official views of the National Institutes of Health....