Skip to main content

We narrowed to 964 results for: tes

Showing: 41 - 60 of 964 results
  1. TALEN Engineering

    Type
    Collection
    ... TALE transcriptional activator target sites and then generates individual user-friendly graphical roadmaps... ( Sander et al., Nat Biotechnol. 2011 ) Rats ( Tesson et al., Nat Biotechnol. 2011 ) Human somatic cells...monomeric TALE transcriptional activator target sites and to simplify the construction of TALEN expression...
  2. Antibody Production

    Type
    Collection
    ...Quality Control Each lot of antibody undergoes testing, either in-house or through outside labs, to confirm...storing at -20 °C. Each antibody catalog item is tested for shipping stability by incubating at 37 °C for..., freezing at -80 °C, thawing on ice, and then testing for loss of potency against a non-treated control...recommended assays. If an antibody has passed stability testing, it may ship at room temperature. However, Addgene...
  3. Plant Plasmids and Resources

    Type
    Collection
    ... easy assembly of one or more gRNA expression cassettes - Qi-Jun Chen. Cas9 and gRNA backbone for use...create plant expression vectors containing several cassettes and generate multi-construct transgenic plants...The ABRC collects, preserves, reproduces, and distributes diverse seed and other stocks of Arabidopsis ... (Link opens in a new window) - The initiative promotes interdisciplinary exchange, open technologies,...
  4. CRISPR Plasmids - Mammalian Expression

    Type
    Collection
    ...changes, researchers use ssDNA or dsDNA repair templates with homology to the DNA flanking the DSB and ...hypermutation in a 100 bp window. This technique creates diverse populations of mutants for directed evolution...adenosine deaminase to catalytically dead Cas13b creates a programmable RNA editor that converts adenosine... transcription factor and other protein binding sites. ID Plasmid Gene/Insert Promoter Selectable Marker...
  5. Viral Production

    Type
    Collection
    ...The data is also used to determine recombination rates in FLEX/DIO/fDIO constructs. Endotoxin Endotoxin...sterility. Transducibility Some viral vectors are tested in vitro and in vivo for gene expression and/or...line was obtained from Takara, and is routinely tested for mycoplasma contamination using mycoplasma detection... 2 weeks post-thaw, cell culture supernatant is tested for mycoplasma contamination. To date, Addgene ...
  6. Brain Initiative Collection

    Type
    Collection
    ...ID Plasmid Description PI Viral Preps Addgene distributes ready-to-use viral preps made from plasmids in...and targeted to the neuronal soma and proximal dendrites in a viral vector Hillel Adesnik 107708-AAV9 pAAV-hSynapsin...ChroME targeted to the neuronal soma and proximal dendrites and separated from nuclear mRuby3 by P2A in a ...and targeted to the neuronal soma and proximal dendrites under the control of internal ribosome entry sequence...recombination Ofer Yizhar Antibodies Addgene distributes ready-to-use recombinant antibodies made from...
  7. AAV Viral Preps

    Type
    Collection
    ...includes titering, purity assessment, sterility testing, and viral genome sequencing (VGS). In-stock AAV...Neuronal Tracing Rabies Virus-Based Serotype Serotype Testing Samples Small samples of control AAV vectors for...CAP-B10, CAP-B22 University of Florida Serotype Testing Panel for the Eye and Brain For enhanced transduction...
  8. All Antibodies

    Type
    Collection
    ...Antibodies All Antibodies All Antibodies Addgene distributes ready-to-use recombinant antibodies. These monoclonal...recommended applications based on our in-house testing and data provided by trusted outside labs – with... represent the official views of the National Institutes of Health. Need Some Help? Browse some of our...
  9. Adenovirus Plasmids

    Type
    Collection
    ...plasmid, are recombined into a DNA molecule that incorporates sequences from both plasmids. This DNA molecule...for the AdenoBuilder genome assembly system; consolidates the regions present in pAd5-B6 ∆E3-GFP and pAd5... Vogelstein 16407 pAdEasy 2-GFP beta-gal Shuttle Test plasmid that contains β-gal and GFP; contains ∼10Kb...
  10. AAV Packaged on Request

    Type
    Collection
    ...such as titering, purity assessment, sterility testing, and viral genome sequencing.... process: Titering Purity assessment Sterility testing Viral genome sequencing (VGS) Find detailed pricing...Addgene does not perform functional or in vivo testing. We recommend that you consult the original paper...
  11. TALEN Plasmids and Kits

    Type
    Collection
    ...both the N and C terminus and induces mutation at rates much higher than the parental vectors. pC-GoldyTALEN... Features include (i) Esp3I (BsmBI) restriction sites for full compatibility with the Golden Gate TALEN... 21179091), as well as (v) distinct selection cassettes on pTAL7a and pTAL7b for enrichment of double-...
  12. Handling Plasmids from Addgene - Purifying Plasmid DNA

    Type
    Protocol
    ... μL of TE. Top Protocol: Phenol-Chloroform Extraction of DNA Samples Add an equal volume of TE-saturated...Denaturing solution Renaturing solution 2 mg/mL RNase A TE or water-saturated phenol-chloroform Chloroform 100%...100% ethanol or isopropanol 90% ethanol 70% ethanol TE buffer 3 M Na-acetate (pH 4.8) Protocol: Generalized...the column using water or a neutral buffer such as TE. You will now have plasmid DNA that has been purified... Water-saturated phenol-chloroform can be used if TE-saturated is not available. Vortex microfuge tube... paper towel for 5-20 min. Resuspend dry DNA with TE (10 mM Tris-HCl pH 8, 0.1 mM EDTA). Pro-Tip DNA resuspension...min. Centrifuge the tube for 5 min at 12,000 g. Notes: Pellet contains proteins, cell fragments, salt ...
  13. DNA Purification Without a Kit

    Type
    Blog Post
    ...DNA is precipitated with alcohol and resuspended in TE buffer. After this, the DNA is ready for use! Plasmid...centrifugation and washed before DNA is eluted with water or TE. The Bishop Lab’s glass milk protocol is adapted ...than 30 minutes and only requires incubating the columns with 1M phosphoric acid for 3 minutes followed...syringe-based method can be completed in 20 to 30 minutes. Additionally, while commercial plasmid prep kits...same as those provided with the kit. Although not tested by the authors, it’s possible that used plasmid... the National Academy of Sciences of the United States of America, 76 2, 615-9 . https://doi.org/10.1073...
  14. Empty Backbones - Choosing Your Perfect Plasmid Backbone

    Type
    Collection
    ...carry in the target cell. These vectors allow you to test the function of your gene of interest in a controlled...zebrafish insulin promoter vector with multiple cloning sites Browse our full Fluorescent Protein...inserted into this firefly luciferase reporter to test for their effects on protein production AAV-GfaABC1D-MCS...
  15. Validated gRNA Sequences

    Type
    Collection
    ... 42242 cut S. pyogenes 23360964 Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740...pyogenes 26178787 Winslow negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740...GGTTTTGGACACTGGAACCG 49331 cut S. pyogenes 24326186 Liu near LoxP sites synthetic CGAAGTTATATTAAGGGTTC 69992 cut S. pyogenes...
  16. Institute for Protein Innovation

    Type
    Collection
    ...accessible toolset for scientists worldwide. Figure courtesy of IPI Browse Glypican Antibodies ID Recombinant...blocking ligand binding and receptor function Figure courtesy of IPI Browse Integrin Antibodies ID Recombinant...
  17. CRISPR Plasmids - Cascade-Cas3

    Type
    Collection
    ...CRISPR family. After nicking the target DNA, Cas3 initiates single-strand DNA degradation. This degradation...targeted strand non-specifically along the way. Cas3 initiates a final double-strand break, either due to a boundary...
  18. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...Brzezinski Lab CRISPR Collection The Brzezinski lab investigates gene regulation in the context of the developing...fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide expressing plasmids dCas9-KRAB-MeCP2...
  19. Chemogenetics Plasmids

    Type
    Collection
    ...oxidizes its substrate (luciferin), it generates light that activates the opsin to either excite or inhibit...
  20. E11 Bio PRISM Collection

    Type
    Collection
    ...proteins to label and detect multiple injection sites in the same tissue, as well as barcoding with specific...Stochastic infection of pooled AAVs delivered in vivo generates unique combinations of protein bits. B) Multiplex...
Showing: 41 - 60 of 964 results