-
Plasmid#99049PurposeTranscription Factor chassis for activation domains. mCherry, Zif268 DNA binding domain, estrogen response domainDepositorInsertsUseTagsExpressionYeastMutationPromoterAvailable sinceMarch 1, 2018AvailabilityAcademic Institutions and Nonprofits only
-
p426_Cas9_gRNA-HIS3b
Plasmid#87402PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting HIS3b sequence AATATAGAGTGTACTAGAGG in yeast chromosome 15.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting HIS3b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_Crz1(19A)_CLASP_RGS2membrane
Plasmid#133085PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.DepositorInsertCrz1*-CLASP
UseTagsExpressionBacterial and YeastMutationPromoterpADH1Available sinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[3]-C (LEU2)
Plasmid#177796PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[3] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsDHFR F[3]ExpressionYeastMutationPromoterADH1Available sinceJan. 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-DHFR F[1,2]-C (TRP1)
Plasmid#177795PurposeGateway destination vector to insert genes of interest having a C-terminal DHFR F[1,2] fusion for DHFR-PCA/BFG-PCA assays.DepositorTypeEmpty backboneUseTagsDHFR F[1,2]ExpressionYeastMutationPromoterADH1Available sinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p425_Cas9_gRNA_LEU_1014a
Plasmid#87407Purposep425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1014a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS208a
Plasmid#87383PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS208a sequence GTCCGCTAAACAAAAGATCT in yeast chromosome 2.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS208a
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEF1a-RoninDHSA-FLAG-IRES-Neo
Plasmid#28021DepositorInsertRonin (THAP11 Human)
UseTagsFLAGExpressionMammalianMutationDHSA mutation (Y246A) of the previously defined H…PromoterAvailable sinceMay 17, 2011AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
G30, Cdc20-mCherry-AID tagging
Plasmid#130270PurposeTagging the Saccharomyces cerevisiae Cdc20 gene with a mCherry and auxin-degron tag, via homologous recombinationDepositorInsertCdc20/mCherry-AID(71-114)-tCYC1-NatMX (CDC20 Budding Yeast, Synthetic)
UseTagsAID(71-114) and mCherryExpressionYeastMutationPromoterNative promoterAvailable sinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
nuc-yHS1-M7A,H102A
Plasmid#159168PurposeNuclear labile heme reporterDepositorInsertnuc-yHS1-M7A,H102A
UseTagsSV40 NLSExpressionYeastMutationMutated both Met 7 and His 102 of the cyt b562 mo…PromoterGPDAvailable sinceSept. 29, 2020AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-H517Q-YFP
Plasmid#29620DepositorInsertFUS (FUS Human)
UseTagsYFPExpressionYeastMutationH517QPromoterAvailable sinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-R521H-YFP
Plasmid#29624DepositorInsertFUS (FUS Human)
UseTagsYFPExpressionYeastMutationR521HPromoterAvailable sinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-YPRCd15c
Plasmid#87404PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting YPRCd15c
UseCRISPRTagsExpressionMutationPromoterADH1, pTyrosineAvailable sinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ cMyc-oDam_f_GFPoNLS
Plasmid#85818PurposeiDamID plasmid. To express transiently the c-Myc-tagged and optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertcMyc oDam_f_GFPoNLS
UseTagscMyc and oNLS (optimized nuclear localization sig…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…PromoterAvailable sinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-170aa-YFP
Plasmid#29596DepositorInsertFUS-1-170aa (FUS Human)
UseTagsYFPExpressionYeastMutationContains FUS aa# 1-170PromoterAvailable sinceApril 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-501aa-YFP
Plasmid#29601DepositorInsertFUS-1-501aa (FUS Human)
UseTagsYFPExpressionYeastMutationContains FUS aa# 1-501PromoterAvailable sinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-373aa-YFP
Plasmid#29598DepositorInsertFUS-1-373aa (FUS Human)
UseTagsYFPExpressionYeastMutationContains FUS aa# 1-373PromoterAvailable sinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pPICZ-pre-Ost1-alphaf(I)-Btl2
Plasmid#117667PurposeStudy secretion efficiency of Btl2DepositorInsertpre-Ost1-alphaf(I)-Btl2
UseTagsExpressionYeastMutationThis plasmid encodes the lipase Btl2 together wit…PromoterpAOX1Available sinceDec. 12, 2018AvailabilityAcademic Institutions and Nonprofits only