173,387 results
-
Plasmid#232174PurposeExpression of replication/capsid proteins for AAV serotype 1DepositorInsertRep52, VP1 of AAV-1
UseAAVExpressionMammalianAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (AAV1)
Viral Prep#162377-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (#162377). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP8s-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUAS-NanoLuc
Plasmid#87696PurposeGal4VP16 driven expression of NanoLucDepositorInsertNanoLuc
Tagsnuclear localization signalExpressionMammalianAvailable SinceApril 26, 2017AvailabilityAcademic Institutions and Nonprofits only -
LentiGuide-Neo
Plasmid#139449PurposeLentiviral vector with gRNA scaffold and neomycin selectable markerDepositorInsertno sgRNA inserted; resistance gene: neoR
UseLentiviralExpressionMammalianPromoterEF-1a / U6Available SinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCDNA3.1(+)-CMV-bArrestin2-TEV
Plasmid#107245PurposeVector for preparation of stable cell lines expressing Barrestin2-TEV fusion protein in lieu of the HTLA cell line.DepositorInsertARRB2
TagsTEV(NIA), tobacco etch virus NIAExpressionMammalianPromoterCMVAvailable SinceMay 9, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRVL-5
Plasmid#104583PurposeContains human IgG1 CH1/CH2/CH3 domains, for cloning of antibody VH domains using SapI restriction enzyme. Full Fc-mediated immune effector functionsDepositorAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRVL-4
Plasmid#104582PurposeContains human kappa CL domain, for cloning of antibody VL domains using SapI restriction enzyme.DepositorInsertHuman CL kappa
ExpressionMammalianPromoterCMVAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1346 U6-B2M sgRNA Gag-pol v2
Plasmid#201917PurposeCas9-EDV production plasmid. Expresses the Gag-pol (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorInsertsGag-pol
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available SinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hChR2(H134R)-mCherry (AAV9)
Viral Prep#26976-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-hChR2(H134R)-mCherry (#26976). In addition to the viral particles, you will also receive purified pAAV-hSyn-hChR2(H134R)-mCherry plasmid DNA. Synapsin-driven, humanized channelrhodopsin H134R mutant, fused to mCherry for optogenetic activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceJan. 26, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNUT N6His hTFNG
Plasmid#67240PurposeExpresses N-His tagged nonglycosylated human serum transferrin in mammalian cellsDepositorInserthuman serum transferrin (TF Human)
TagsN-terminal signal peptide, 4 aa link, 6 His, Fact…ExpressionMammalianMutationAsn413 Asp, Asn611AspPromoterSV40Available SinceSept. 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
Vimentin-pLJM5
Plasmid#189868PurposeExpresses human Vimentin in mammalian cellsDepositorInsertVimentin
Tagsm-CherryExpressionMammalianAvailable SinceSept. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
mAIRN HO
Plasmid#207411PurposeMammalian-cell-based plasmid system that expresses mAIRN (an R-loop-forming transcript) upon dox-induction, which will further cause head-ON transcription-replication conflict (HO TRC).DepositorInsertmAIRN
ExpressionBacterial and MammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
mAIRN CD
Plasmid#207412PurposeMammalian-cell-based plasmid system that expresses mAIRN (an R-loop-forming transcript) upon dox-induction, which will further cause co-directional transcription-replication conflict (CD TRC).DepositorInsertmAIRN
ExpressionBacterial and MammalianAvailable SinceMarch 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
M50 Super 8x TOPFlash
Plasmid#12456PurposeBeta-catenin reporter. TCF/LEF sites upstream of a luciferase reporter.DepositorInsertTCF/LEF binding sites (Ctnnb1 )
UseLuciferaseAvailable SinceMarch 13, 2007AvailabilityAcademic Institutions and Nonprofits only -
pU6-tevopreq1-GG-acceptor
Plasmid#174038PurposePrime editing in mammalian cellsDepositorTypeEmpty backboneExpressionMammalianPromoterhU6Available SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
ECFP HO
Plasmid#207413PurposeMammalian-cell-based plasmid system that expresses ECFP (a non R-loop-forming transcript) upon dox-induction, which will further cause head-ON transcription-replication conflict (HO TRC).DepositorInsertECFP
ExpressionBacterial and MammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
ECFP CD
Plasmid#207414PurposeMammalian-cell-based plasmid system that expresses ECFP (a non R-loop-forming transcript) upon dox-induction, which will further cause co-directional transcription-replication conflict (CD TRC).DepositorInsertECFP
ExpressionBacterial and MammalianAvailable SinceJan. 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSP2-96-merTetO-EFS-BLaR
Plasmid#118713PurposeContains an optimized 96-mer TetO repeat for imaging of desired lociDepositorInsertsBlasticidin resistance gene
EFS-NS promoter
ExpressionMammalianPromoterEFS-NSAvailable SinceFeb. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tdTomato (AAV9)
Viral Prep#28306-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-FLEX-tdTomato (#28306). In addition to the viral particles, you will also receive purified pAAV-FLEX-tdTomato plasmid DNA. CAG-driven, Cre-dependent tdTomato expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (Cre-dependent)Available SinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only