169,450 results
-
Plasmid#85966PurposeTet/Dox inducible shRNA lentivirus with puromycin selectionDepositorHas ServiceCloning Grade DNATypeEmpty backboneUseLentiviral and RNAiPromoterH1 / TetOAvailable SinceFeb. 28, 2017AvailabilityAcademic Institutions and Nonprofits only
-
pcDNA GNSTM-3-RVG-10-Lamp2b-HA
Plasmid#71294PurposeEncodes (N to C): GNSTM glycosylation motif, 3 residue spacer, RVG peptide, 10 residue spacer, Lamp2b (exosomal transmembrane protein), 3 residue spacer, HA tag.DepositorInsertLamp2b (LAMP2 Human)
TagsGNSTM glycosylation motif, HA, Lamp2 signal pepti…ExpressionMammalianPromoterCMVAvailable SinceDec. 10, 2015AvailabilityAcademic Institutions and Nonprofits only -
pECE-M2-PAK2 wt
Plasmid#31663DepositorAvailable SinceApril 11, 2012AvailabilityAcademic Institutions and Nonprofits only -
miniCMV-(mNeonGreen)4-tDeg
Plasmid#129402Purpose(mNeonGreen)4-tDeg fluorogenic proteinDepositorInsert(mNeonGreen)-tDeg
ExpressionMammalianPromoterminiCMV (GGTAGGCGTGTACGGTGGGAGGCCTATATAAGCAGAGCT)Available SinceAug. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
CROP-seq-opti
Plasmid#106280PurposeA version of the CROP-seq plasmid as presented in Datlinger et al. that contains the sgRNA-(F+E)-combined optimized backbone for CRISPRi from Chen et al.DepositorInsertEF1a-Puro-WPRE-hU6-gRNA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceMarch 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-hM3D(Gq)-mCherry (AAV Retrograde)
Viral Prep#50474-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-hSyn-hM3D(Gq)-mCherry (#50474). In addition to the viral particles, you will also receive purified pAAV-hSyn-hM3D(Gq)-mCherry plasmid DNA. hSyn-driven hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherryAvailable SinceOct. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1-Peredox-mCherry
Plasmid#32383DepositorInsertPeredox-mCherry
ExpressionMammalianPromoterCMVAvailable SinceSept. 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
phOct4-EGFP
Plasmid#38776DepositorAvailable SinceDec. 13, 2012AvailabilityAcademic Institutions and Nonprofits only -
rAAV2-retro helper
Plasmid#81070Purposeretrograde AAV helper vector, carrying rep and modified capsid geneDepositorInsertsrep
rAAV2-retro cap
UseAAV and Unspecified; Helper vectorMutationPro2Ala, possibly Asp613Gly and changes made to A…Available SinceAug. 30, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCas
Plasmid#62225PurposeConstitutive expression of cas9 and inducible expression of lambda RED and sgRDepositorHas ServiceCloning Grade DNAInsertcas9
UseCRISPR; Lambda red recombinaseExpressionBacterialPromoternative cas9 promoterAvailable SinceApril 17, 2015AvailabilityAcademic Institutions and Nonprofits only -
c-myc-PT3EF1a
Plasmid#92046PurposeExpresses c-Myc in mammalian cellsDepositorAvailable SinceJuly 15, 2017AvailabilityAcademic Institutions and Nonprofits only -
GFP-Mfn1
Plasmid#141154PurposeMammalian expression and labeling mitofusin 1DepositorAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pET His6 MBP TEV LIC cloning vector (2M-T)
Plasmid#29708DepositorTypeEmpty backboneTags6xHis, MBP, and TEV cleavage siteExpressionBacterialPromoterT7Available SinceAug. 17, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLJC5-Tmem192-3xHA
Plasmid#102930PurposeLentiviral expression of a lysosomal tag (Tmem192-HA)DepositorAvailable SinceNov. 29, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLX313-Firefly luciferase
Plasmid#118017PurposeConstitutive expression of Firefly luciferaseDepositorInsertFirefly luciferase
UseLentiviralExpressionMammalianPromoterEF1alphaAvailable SinceJan. 3, 2019AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1 Dendra2
Plasmid#103967PurposeMammalian expression of fluorescent protein Dendra2 used for transfection efficiency controlDepositorInsertDendra2
ExpressionMammalianAvailable SinceJuly 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
EcNR2 Strain
Bacterial Strain#26931DepositorBacterial ResistanceChloramphenicol and AmpicillinAvailable SinceJan. 28, 2011AvailabilityAcademic Institutions and Nonprofits only -
MSCVneo-HA-ER-Hoxb8
Plasmid#222291PurposeThe most commonly used plasmid for the generation of ER-Hoxb8 conditionally immortalized myeloid cell lines.DepositorUseRetroviralTagsHAExpressionMammalianMutationThe estrogen receptor hormone binding domain cont…Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (AAV1)
Viral Prep#100854-AAV1PurposeReady-to-use AAV1 particles produced from pAAV.Syn.NES-jRGECO1a.WPRE.SV40 (#100854). In addition to the viral particles, you will also receive purified pAAV.Syn.NES-jRGECO1a.WPRE.SV40 plasmid DNA. Synapsin-driven GECO1a calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynAvailable SinceApril 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLX303-ZIM3-KRAB-dCas9
Plasmid#154472PurposeExpresses ZIM3 KRAB domain fused to the N terminus of dCas9DepositorInsertZIM3 (ZIM3 Synthetic)
UseLentiviralTagsHAExpressionMammalianMutationIncludes ZIM3 aa 1-100Available SinceOct. 5, 2020AvailabilityAcademic Institutions and Nonprofits only