174,398 results
-
Viral Prep#114470-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Ef1a-mCherry (#114470). In addition to the viral particles, you will also receive purified pAAV-Ef1a-mCherry plasmid DNA. EF1a-driven mCherry expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherryAvailable SinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only
-
Mouse sgRNA library Brie in lentiGuide-Puro (Lentiviral Prep)
Viral Prep#73633-LVPurposeReady-to-use Lentiviral Prep particles produced from Mouse sgRNA library Brie in lentiGuide-Puro (#73633). In addition to the viral particles, you will also receive purified Mouse sgRNA library Brie in lentiGuide-Puro plasmid DNA. <p><p>Ready-to-use lentiviral pooled library for CRISPR screening in mouse cells. Use on cells that are stably expressing Cas9 to make edits across 19,674 genes in the mouse genome.</p></p>DepositorAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLV-mitoGFP
Plasmid#44385DepositorInsertmitoGFP (COX8A Human)
UseLentiviralTagsCox8 targeting sequence and GFPExpressionMammalianPromoterCMVAvailable SinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only -
AA006
Plasmid#216056PurposeFragmid fragment: (2A Selection) Blasticidin resistanceDepositorHas ServiceCloning Grade DNAInsertT2A_v1.1; BlastR_v1.1; Stop
UseFragmentAvailable SinceApril 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pU6-pegRNA-GG-acceptor
Plasmid#132777PurposePrime editing in mammalian cellsDepositorInsertExchangeable cassette
ExpressionMammalianMutationSee manuscriptPromoterU6Available SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
4787 TRV2-eTnpBc-HHreRNA4PDS
Plasmid#251817PurposeEditing Photene desaturase (PDS) genes in Nicotiana benthamianaDepositorInsertEnhanced variant of ISDra2 eTnpBc with guide targeting NbPDS flanked by HH-HDV ribozymes
TagsAtFDnlsExpressionPlantMutationN4Y/R110K/V192L/L222IAvailable SinceMarch 9, 2026AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-DIO-hM3D(Gq)-mCherry (AAV9)
Viral Prep#44361-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-DIO-hM3D(Gq)-mCherry (#44361). In addition to the viral particles, you will also receive purified pAAV-hSyn-DIO-hM3D(Gq)-mCherry plasmid DNA. Syn-driven, Cre-dependent, hM3D(Gq) receptor with an mCherry reporter for CNO-induced neuronal activation. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsmCherry (Cre-dependent)Available SinceSept. 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEcgRNA
Plasmid#166581PurposeCRISPR-Cas9-assisted genome editing in Escherichia coliDepositorInsertccdB
ExpressionBacterialAvailable SinceApril 6, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-VSV-G
Plasmid#8454PurposeEnvelope protein for producing lentiviral and MuLV retroviral particles. Use in conjunction with a packaging vector such as pCMV-dR8.2 dvpr (lentiviral) or pUMVC (MuLV retroviral).DepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 20, 2005AvailabilityAcademic Institutions and Nonprofits only -
pEcCas
Plasmid#73227PurposeConstitutive expression of cas9 and inducible expression of lambda RED and sgRNADepositorInsertsCas9
sgRNA
UseCRISPR; Red recombinaseExpressionBacterialPromoternative promoterAvailable SinceJune 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro
Plasmid#52963PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and puromycin resistance from EF-1a promoter. 3rd generation lentiviral backbone.DepositorInsertsS. pyogenes sgRNA cassette
Puromycin resistance
UseCRISPR and LentiviralExpressionMammalianPromoterEf1-a and hU6Available SinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-tdTomato (codon diversified) (AAV Retrograde)
Viral Prep#59462-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-CAG-tdTomato (codon diversified) (#59462). In addition to the viral particles, you will also receive purified pAAV-CAG-tdTomato (codon diversified) plasmid DNA. tdTomato expression control. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (codon diversified)Available SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
Flag-TurboID
Plasmid#124646PurposeExpresses Flag-TurboID fusion for proximity labelingDepositorTypeEmpty backboneTagsFlagExpressionMammalianPromoterCMVAvailable SinceApril 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
PLKO.1-Scrambled
Plasmid#136035PurposeScrambled shRNA (negative control) inserted into the PLKO.1 plasmid (CCTAAGGTTAAGTCGCCCTCG)DepositorInsertNone (Scrambled)
UseLentiviralExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
XLone-GFP
Plasmid#96930PurposeTunable and temporal expression control of GFPDepositorInsertGreen Fluorescent Protein
ExpressionMammalianPromoterTRE3GSAvailable SinceAug. 3, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV_BiSSTe4_dTomato_nlsdTomato (AAV PHP.eB)
Viral Prep#213944-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV_BiSSTe4_dTomato_nlsdTomato (#213944). In addition to the viral particles, you will also receive purified pAAV_BiSSTe4_dTomato_nlsdTomato plasmid DNA. Bicistronic expression of dTomato and nuclear-targeted dTomato under the control of the SST interneuron-targeting enhancer E4. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorTagsdTomatoAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKC117_pLenti_TetOff_MVP_IRES_PABPC1_INT
Plasmid#242113PurposeTet- or Dox-repressible expression of MVP and PABPC1 fused to INT (human PARP4 fragment)DepositorUseLentiviralMutationPABPC1 aa 1-370, PARP4 aa 1562-1724PromoterTRE3GAvailable SinceDec. 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tdTomato (AAV9)
Viral Prep#28306-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-FLEX-tdTomato (#28306). In addition to the viral particles, you will also receive purified pAAV-FLEX-tdTomato plasmid DNA. CAG-driven, Cre-dependent tdTomato expression control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (Cre-dependent)Available SinceNov. 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-tevopreq1-GG-acceptor
Plasmid#174038PurposePrime editing in mammalian cellsDepositorTypeEmpty backboneExpressionMammalianPromoterhU6Available SinceOct. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV2/6
Plasmid#240485PurposeAAV packaging plasmid expressing AAV2 Rep protein and AAV6 capsid proteinDepositorInsertAAV2 Rep and AAV6 Cap
UseAAVExpressionMammalianAvailable SinceJuly 25, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits