-
Plasmid#176297PurposeExpresses DCK* and GFP from the same transcriptDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable sinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Kif2c
Plasmid#208651PurposeMammalian expression plasmid expressing eGFP-Kif2c driven by CMV promoterDepositorInsertKif2c (KIF2C Human)
UseTagseGFPExpressionMammalianMutationPromoterAvailable sinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-dnMCAK
Plasmid#208650PurposeMammalian expression plasmid expressing eGFP-dnMCAK driven by CMV promoterDepositorInsertKif2c (Kif2c Cricetulus griseus (Chinese hamster))
UseTagseGFPExpressionMammalianMutationS92A , S106A , S108A, S112A , S186A, H530A, R534A…PromoterAvailable sinceDec. 11, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLX304-DCK*-IRES-Td
Plasmid#176298PurposeExpresses DCK* and TdTomato from the same transcriptDepositorInsertMutant Deoxycytidine Kinase (DCK*, S74E R104M D133A) (DCK Human)
UseLentiviralTagsV5ExpressionMammalianMutationS74E R104M D133APromoterCMVAvailable sinceApril 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-NAGK
Plasmid#23785DepositorInsertNAGK (NAGK Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pLEX307 hDVL1
Plasmid#102863PurposeExpresses human DVL1 in mammalian cellsDepositorInserthuman Dishevelled 1 (DVL1) (DVL1 Human)
UseLentiviralTagsExpressionMammalianMutationChanged alanine 2 to glycine. Likely due to poly…PromoterEF1AAvailable sinceDec. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-FLAG-3C-ORF1_mClover3-TEV-ORF2
Plasmid#105801PurposeConcomitant expression of two proteins. One protein expressed with FLAG, cleavable by 3C or enterokinase; second protein expressed with mClover3, cleavable by TEV protease; tags positions: N-termini.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: FLAG-3C; ORF2: mClover3-TEVExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-FRET-ORF1-3C-Cerulean_ORF2-TEV-Venus
Plasmid#105805PurposeConcomitant expression of two proteins. One protein expressed with Cerulean, cleavable by 3C; second protein expressed with Venus, cleavable by TEV. Useful for protein interaction analysis by FRET.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-Cerulean; ORF2: TEV-VenusExpressionMammalianMutationPromoterAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAM-DCA-HA-Ast-3-NP-1-IRES-mCherry-WPRE
Plasmid#159630PurposeAAV expression of HA Allatostatin-3, neurophysin, IRES mCherry under the CAG promoterDepositorInsertAst (AstA Fly)
UseAAVTagsHA, IRES, mCherry, and neurophysin-1ExpressionMammalianMutationPromoterDCA (same as CAG promoter)Available sinceOct. 30, 2020AvailabilityAcademic Institutions and Nonprofits only -
pKK-BI16-ORF1-3C-FLAG_ORF2-TEV-mClover3
Plasmid#105803PurposeConcomitant expression of two proteins. One protein expressed with FLAG, cleavable by 3C protease; second protein expressed with mClover3, cleavable by TEV protease; tags positions: C-termini.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-FLAG; ORF2: TEV-mClover3ExpressionMammalianMutationPromoterAvailable sinceFeb. 12, 2018AvailabilityAcademic Institutions and Nonprofits only -
pKK-FRET-ORF1-3C-Cerulean_ORF2-TEV-Amber
Plasmid#105806PurposeConcomitant expression of two proteins. One protein expressed with Cerulean, cleavable by 3C; second protein expressed with Amber, cleavable by TEV. Control for protein interaction analysis by FRET.DepositorTypeEmpty backboneUseFlp-in competentTagsORF1: 3C-Cerulean; ORF2: TEV-AmberExpressionMammalianMutationPromoterAvailable sinceMay 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pD649-HAsp-CLMP-COMP5AP-AviTag-9xHis
Plasmid#157209PurposeMammalian expression of cell-surface protein extracellular domain fused to COMP5AP-AviTag-9xHis. Protein is secreted from cells.DepositorInsertCLMP (CLMP Human)
UseTagsCOMP5AP-AviTag-9xHisExpressionMammalianMutationPromoterCMV/SP6Available sinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E7-D192D
Plasmid#154024PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 7 c.576C>T, p.D192D (Synonymous Mutation)DepositorInsertBAP1 Exon 7 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.576C>T, p.D192DPromoterAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
RG6-BAP1_E11-G312G
Plasmid#154026PurposeBichromatic Fluorescent Splicing Reporter Minigene for Mutant BAP1 Exon 11 c.936T>G, p.G312G (Synonymous Mutation)DepositorInsertBAP1 Exon 11 Fused to DsRed1 and eGFP (BAP1 Human)
UseSplicing reporterTagsDsRed1, FLAG, SV40 NLS, and eGFPExpressionMammalianMutationBAP1 c.936T>G, p.G312GPromoterAvailable sinceFeb. 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
Adeno FT
Plasmid#101824PurposeAdenovirus for the expression of gRNAs targeting intron 17 of murine Fgfr3 and intron 6 of murine Tacc3DepositorUseAdenoviralTagsFLAG-Cas9ExpressionMutationPromoterU6 and CBhAvailable sinceNov. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223_GCET2_p.H177Q
Plasmid#81320PurposeGateway Donor vector containing GCET2 , part of the Target Accelerator Plasmid Collection.DepositorInsertGCET2 (GCSAM Human)
UseGateway entry vectorTagsExpressionMutationL5V, H177QPromoterNoneAvailable sinceApril 24, 2017AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-FN3K
Plasmid#23621DepositorInsertFN3K (FN3K Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pDONR223-FN3KRP
Plasmid#23679DepositorInsertFN3KRP (FN3KRP Human)
UseGateway donor vectorTagsExpressionMutationPromoterAvailable sinceJuly 30, 2010AvailabilityAcademic Institutions and Nonprofits only -
pT7CFE1-Nhis-GST-CHA-YTH domain (YTHDC1, 317-532)
Plasmid#102277PurposeFor expression of His-GST-tagged human YTHDC1 YTH domain using mammalian cell-free protein expression system (1-step human high-yield mini IVT kit, cat. #88890, Thermo Fisher Scientific)DepositorInsertYTH domain of human YTHDC1 (317-532) (YTHDC1 Human)
UseFor mammalian cell-free protein expression system…TagsGST, HA, and HISExpressionMutationPromoterT7Available sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only