-
Plasmid#12259PurposeVSV-G envelope expressing plasmidDepositorInsertVSV G
UseLentiviral; EnvelopeTagsExpressionMammalianMutationPromoterAvailable sinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
psPAX2
Plasmid#12260Purpose2nd generation lentiviral packaging plasmid. Can be used with 2nd or 3rd generation lentiviral vectors and envelope expressing plasmid (Addgene#12259)DepositorTypeEmpty backboneUseLentiviral; PackagingTagsExpressionMammalianMutationPromoterAvailable sinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pMDLg/pRRE
Plasmid#12251Purpose3rd generation lentiviral packaging plasmid; Contains Gag and Pol; also requires pRSV-Rev (Addgene#12253) and envelope expressing plasmid (Addgene#12259)DepositorInsertHIV-1 GAG/POL
UseLentiviral; PackagingTagsExpressionMammalianMutationPromoterAvailable sinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRSV-Rev
Plasmid#12253Purpose3rd generation lentiviral packaging plasmid; Contains Rev; also requires pMDLg/pRRE (Addgene#12251) and envelope expressing plasmid (Addgene#12259)DepositorInsertRev (rev )
UseLentiviral; PackagingTagsExpressionMammalianMutationPromoterAvailable sinceAug. 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP (PX458)
Plasmid#48138PurposeCas9 from S. pyogenes with 2A-EGFP, and cloning backbone for sgRNADepositorHas ServiceCloning Grade DNAInserthSpCas9
UseCRISPRTags3XFLAG and GFPExpressionMammalianMutationPromoterCbhAvailable sinceOct. 29, 2013AvailabilityAcademic Institutions and Nonprofits only -
AAV.TBG.PI.Cre.rBG (AAV8)
Viral Prep#107787-AAV8PurposeReady-to-use AAV8 particles produced from AAV.TBG.PI.Cre.rBG (#107787). In addition to the viral particles, you will also receive purified AAV.TBG.PI.Cre.rBG plasmid DNA. TBG-driven expression of Cre. These AAV preparations are suitable purity for injection into animals.DepositorPromoterTBGTagsNoneAvailable sinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2
Plasmid#52961PurposeReplaces original lentiCRISPRv1 (Addgene Plasmid 49535) and produces ~10-fold higher titer virus. 3rd generation lentiviral backbone.DepositorInsertsCas9
Puromycin resistance
UseCRISPR and LentiviralTagsFLAGExpressionMammalianMutationPromoterEFS-NSAvailable sinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (AAV9)
Viral Prep#162377-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-syn-FLEX-jGCaMP8s-WPRE (#162377). In addition to the viral particles, you will also receive purified pGP-AAV-syn-FLEX-jGCaMP8s-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of calcium sensor GCaMP8s (more sensitive). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLentipuro3/TO/V5-GW/EGFP-Firefly Luciferase
Plasmid#119816Purpose3rd generation lentiviral plasmid for expression of EGFP Firefly Luciferase fusion protein in mammalian cellsDepositorInsertsLuciferase
Puromycin
UseLentiviral and LuciferaseTagsEGFP and V5ExpressionMammalianMutationStop codon removed in the frame of the V5 frame v…PromoterCMV/TO and Human Phosphoglycerate kinaseAvailable sinceJan. 2, 2019AvailabilityIndustry, Academic Institutions, and Nonprofits -
pUCmini-iCAP-PHP.eB
Plasmid#103005Purposenon-standard AAV2 rep-AAV-PHP.eB cap plasmid with AAV cap expression controlled by a tTA-TRE amplification systemDepositorInsertSynthetic construct isolate AAV-PHP.eB VP1 gene
UseAAVTagsExpressionMammalianMutationPromoterp41Available sinceMarch 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_ACh3.0 (AAV9)
Viral Prep#121922-AAV9PurposeReady-to-use AAV9 particles produced from pAAV-hSyn-GRAB_ACh3.0 (#121922). In addition to the viral particles, you will also receive purified pAAV-hSyn-GRAB_ACh3.0 plasmid DNA. Syn-driven expression of the genetically-encoded fluorescent acethycholine(ACh) sensor GRAB-ACh3.0. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-flex-iGABASnFR2-WPRE (AAV1)
Viral Prep#218877-AAV1PurposeReady-to-use AAV1 particles produced from pGP-AAV-syn-flex-iGABASnFR2-WPRE (#218877). In addition to the viral particles, you will also receive purified pGP-AAV-syn-flex-iGABASnFR2-WPRE plasmid DNA. Syn-driven, Cre-dependent expression of the improved GABA sensor iGABASnFR2 (positive change in fluorescence). These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceSept. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX330-U6-Chimeric_BB-CBh-hSpCas9
Plasmid#42230PurposeA human codon-optimized SpCas9 and chimeric guide RNA expression plasmid.DepositorArticleHas ServiceCloning Grade DNAInserthumanized S. pyogenes Cas9
UseCRISPRTags3xFLAGExpressionMammalianMutationPromoterCBhAvailable sinceFeb. 27, 2013AvailabilityAcademic Institutions and Nonprofits only -
lentiGuide-Puro
Plasmid#52963PurposeExpresses S. pyogenes CRISPR chimeric RNA element with customizable sgRNA from U6 promoter and puromycin resistance from EF-1a promoter. 3rd generation lentiviral backbone.DepositorHas ServiceCloning Grade DNAInsertsS. pyogenes sgRNA cassette
Puromycin resistance
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEf1-a and hU6Available sinceMay 8, 2014AvailabilityAcademic Institutions and Nonprofits only -
V5-TurboID-NES_pCDNA3
Plasmid#107169Purposeexpresses V5-tagged TurboID in the mammalian cytosolDepositorInsertTurboID (BirA mutant)
UseTagsExpressionMammalianMutationQ65P, I87V, R118S, E140K, Q141R, S150G, L151P, V1…PromoterAvailable sinceMay 4, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLVX-XBP1 mNeonGreen NLS
Plasmid#115968PurposeER-stress sensor - XBP1 splicing fluorescent reporter with mNeonGreenDepositorInsertX-box binding protein 1 (XBP1 Synthetic, Human)
UseLentiviralTagsHA tag, c-myc NLS, and mNeonGreenExpressionMammalianMutationPromoterCMVAvailable sinceJuly 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
pLVX-TetOne-Puro-GFP
Plasmid#171123PurposeDoxycycline inducible expression of GFPDepositorInsertEGFP
UseLentiviralTagsExpressionMammalianMutationPromoterAvailable sinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
IFN-Beta_pGL3
Plasmid#102597PurposeIFN-beta promoter driving luciferase. Use in IFN reporter assay.DepositorInsertHuman IFN-Beta promoter (IFNB1 Human)
UseLuciferaseTagsluciferaseExpressionMammalianMutationPromoterAvailable sinceJan. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pAAV-syn-flex-iGluSnFR4s-NGR-WPRE
Plasmid#234441PurposeAAV-mediated expression of glutamate sensor with improved sensitivity and slow deactivation kinetics (4s = slow); NGR vector matches or outperforms PDGFR in all conditions tested.DepositorInsertiGluSnFR4s-NGR
UseAAV and Cre/LoxTagsIgK chain and Myc epi tag-NGR GPI anchorExpressionMammalianMutationPromoterSynapsinAvailable sinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
lenti-EF1a-dCas9-KRAB-Puro
Plasmid#99372Purpose3rd generation lenti vector encoding dCas9-KRAB with 2A puromycin resistance marker (EF1a-dCas9-KRAB-T2A-Puro-WPRE)DepositorInsertdCas9-KRAB-T2A-Puro
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterEF-1aAvailable sinceAug. 18, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAAV-FLEX-tdTomato (AAV PHP.eB)
Viral Prep#28306-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-FLEX-tdTomato (#28306). In addition to the viral particles, you will also receive purified pAAV-FLEX-tdTomato plasmid DNA. CAG-driven, Cre-dependent tdTomato expression control. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCAGTagstdTomato (Cre-dependent)Available sinceFeb. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pGP-AAV-syn-jGCaMP8f-WPRE (AAV9)
Viral Prep#162376-AAV9PurposeReady-to-use AAV9 particles produced from pGP-AAV-syn-jGCaMP8f-WPRE (#162376). In addition to the viral particles, you will also receive purified pGP-AAV-syn-jGCaMP8f-WPRE plasmid DNA. Syn-driven expression of ultrafast calcium sensor GCaMP8f. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsNoneAvailable sinceMay 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pUCmini-iCAP-AAV.CAP-B10
Plasmid#175004Purposenon-standard AAV2 rep-AAV.CAP-B10 cap plasmid with AAV cap expression controlled by a tTA-TRE amplifcation systemDepositorInsertSynthetic construct isolate AAV.CAP-B10 VP1 gene
UseAAVTagsExpressionMammalianMutation7 amino acid substitution between VP1 452 and VP1…Promoterp41Available sinceNov. 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
lentiSAMv2
Plasmid#75112Purposelenti sgRNA cloning backbone with MS2 loops at tetraloop and stemloop 2, dCas9-VP64, and blast resistance marker. Contains BsmBI sites for insertion of spacer sequences.DepositorHas ServiceCloning Grade DNATypeEmpty backboneUseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6 and EF1AAvailable sinceMay 24, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-EGFP (AAV1)
Viral Prep#50465-AAV1PurposeReady-to-use AAV1 particles produced from pAAV-hSyn-EGFP (#50465). In addition to the viral particles, you will also receive purified pAAV-hSyn-EGFP plasmid DNA. hSyn-driven EGFP expression. These AAV preparations are suitable purity for injection into animals.DepositorPromoterSynTagsEGFPAvailable sinceJuly 12, 2019AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-Puro (PX459) V2.0
Plasmid#62988PurposeCas9 from S. pyogenes with 2A-Puro, and cloning backbone for sgRNA (V2.0)DepositorHas ServiceCloning Grade DNAInserthSpCas9-2A-Puro V2.0
UseCRISPRTags2A-Puro and 3XFLAGExpressionMammalianMutationPromoterCbhAvailable sinceMarch 11, 2015AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1 - TRC control
Plasmid#10879PurposeNegative control shRNA vector containing non-hairpin insert.DepositorInsertnon-hairpin 18bp
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterAvailable sinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pLentiFUCCI(CA)5
Plasmid#223176PurposeLentiviral fluorescent ubiquitination-based cell cycle indicator (FUCCI)DepositorInsertFUCCI(CA)5
UseLentiviralTagsAzaleaB5-hCdt1(1/100)Cy(-)_P2A_h2-3-hGem(1/110)ExpressionMammalianMutationPromoterAvailable sinceJan. 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV.CMV.PI.EGFP.WPRE.bGH (AAV8)
Viral Prep#105530-AAV8PurposeReady-to-use AAV8 particles produced from pAAV.CMV.PI.EGFP.WPRE.bGH (#105530). In addition to the viral particles, you will also receive purified pAAV.CMV.PI.EGFP.WPRE.bGH plasmid DNA. CMV-driven EGFP control. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCMVTagsEGFPAvailable sinceJune 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
BirA in pET28a (w400-2)
Plasmid#26624DepositorInsertBirA
UseTagsHisExpressionBacterialMutationPromoterAvailable sinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCS-kI
Plasmid#51553PurposeMammalian phiC31 integrase expression vector. For use in applications where pseudosite integration is not desired.DepositorInsertphiC31 integrase
UseTagsExpressionMammalianMutationPromoterAvailable sinceMarch 3, 2014AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Ef1a-fDIO mCherry (AAV5)
Viral Prep#114471-AAV5PurposeReady-to-use AAV5 particles produced from pAAV-Ef1a-fDIO mCherry (#114471). In addition to the viral particles, you will also receive purified pAAV-Ef1a-fDIO mCherry plasmid DNA. Ef1a-driven, Flp recombinase-dependent expression of mCherry. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherry (Flp-dependent)Available sinceJan. 10, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCK-mScarlet3_C1
Plasmid#189771PurposeConstruct for labelling plasma membranes in mammalian cells using LCK-mScarlet3DepositorInsertLCK-mScarlet3
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceMarch 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2_mCherry_Grx1_roGFP2
Plasmid#155045PurposeFluorescent redox reporterDepositorInsertGlutaredoxin-1 (GLRX Human)
UseLentiviralTagsroGFP2ExpressionMammalianMutationPromoterCMVAvailable sinceSept. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLenti6.2_mCherry_roGFP2_Orp1
Plasmid#155043PurposeFluorescent redox reporterDepositorInsertOrp1 (HYR1 Budding Yeast)
UseLentiviralTagsroGFP2ExpressionMammalianMutationPromoterCMVAvailable sinceOct. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-UGAcS
Plasmid#172135Purposemammalian expression plasmid for a UDP-GlcNAc sensorDepositorInsertUGAcS
UseTagsExpressionMammalianMutationPromoterCMVAvailable sinceNov. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-nEF-Con/Fon DREADD Gi-mCherry (AAV8)
Viral Prep#177672-AAV8PurposeReady-to-use AAV8 particles produced from pAAV-nEF-Con/Fon DREADD Gi-mCherry (#177672). In addition to the viral particles, you will also receive purified pAAV-nEF-Con/Fon DREADD Gi-mCherry plasmid DNA. nEF-driven, Cre- and Flp-dependent hM4D(Gi) receptor with an mCherry reporter for CNO-induced neuronal inhibition. These AAV preparations are suitable purity for injection into animals.DepositorPromoternEFTagsmCherryAvailable sinceFeb. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV.CamKII.GCaMP6s.WPRE.SV40 (AAV9)
Viral Prep#107790-AAV9PurposeReady-to-use AAV9 particles produced from AAV.CamKII.GCaMP6s.WPRE.SV40 (#107790). In addition to the viral particles, you will also receive purified AAV.CamKII.GCaMP6s.WPRE.SV40 plasmid DNA. CamKII-driven GCaMP6s calcium sensor. These AAV preparations are suitable purity for injection into animals.DepositorPromoterCaMKIITagsNoneAvailable sinceMay 15, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLV-mitoDsRed
Plasmid#44386Purpose3rd generation lentiviral vectorDepositorInsertmitoDsRed
UseLentiviralTags61 aa targeting sequence of the P1 isoform F1F0-A…ExpressionMammalianMutationPromoterCMVAvailable sinceJune 12, 2015AvailabilityAcademic Institutions and Nonprofits only