Skip to main content
Addgene

pX330-U6-Chimeric_BB-CBh-hSpCas9
(Plasmid #42230)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 42230 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Cloning Grade DNA 42230-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $105

Backbone

  • Vector backbone
    pUC ori vector
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanized S. pyogenes Cas9
  • Alt name
    SpCas9
  • Alt name
    hSpCas9
  • Insert Size (bp)
    4272
  • Promoter CBh
  • Tag / Fusion Protein
    • 3xFLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Alternate plasmid name: pSpCas9(BB) (PX330)

For plasmid usage, please see the associated publication (Cong et al. Science. 2013, PMID: 23287718), as well as Ran et al. Nat Protoc. 2013, PMID: 24157548.

For more information on Zhang Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/zhang/

Information for Cloning Grade DNA (Catalog # 42230-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $105 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pX330-U6-Chimeric_BB-CBh-hSpCas9 was a gift from Feng Zhang (Addgene plasmid # 42230 ; http://n2t.net/addgene:42230 ; RRID:Addgene_42230)
  • For your References section:

    Multiplex Genome Engineering Using CRISPR/Cas Systems. Cong L, Ran FA, Cox D, Lin S, Barretto R, Habib N, Hsu PD, Wu X, Jiang W, Marraffini LA, Zhang F. Science. 2013 Jan 3. 10.1126/science.1231143 PubMed 23287718