pCRISPRia-v2
(Plasmid #84832)

• Purpose: CRISPRi/a V2 library parental plasmid
• Depositing Lab: Jonathan Weissman
• Publication: Horlbeck et al Elife. 2016 Sep 23;5. pii: e19760. doi: 10.7554/eLife.19760.

Backbone

• Vector backbone: pSICO derivative
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 8200
• Total vector size (bp): 8888
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: sgRNA
• Insert Size (bp): 113
• Promoter: mU6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: BstX1 (not destroyed)
• 3′ cloning site: Blp1 (not destroyed)
• 5′ sequencing primer: gcgccaattctgcagacaaa
• 3′ sequencing primer: CCTTCTCTAGGCACCGGTTC

Gene/Insert 2

• Gene/Insert name: puro-T2A-BFP
• Insert Size (bp): 1371

Resource Information

• Supplemental Documents:
  • pLG1 library vector (pU6-sgRNA Ef1alpha-Puro-T2A-BFP).gb
• Articles Citing this Plasmid:
  • 51 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry