-
PurposeInducible expression of polycistronic 2A spaced OCT4-KLF4-MYC-SOX2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 51543 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFUW
- Total vector size (bp) 13399
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer agagctcgtttagtgaaccg
- 3′ sequencing primer gttgcgtcagcaaacacagt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bythe FUW backbone comes from Plasmid 20724: FUW-tetO-hSOX2 the hOKMS insert comes from Plasmid 27512: pLM-fSV2A
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FUW-tetO-hOKMS was a gift from Tarjei Mikkelsen (Addgene plasmid # 51543 ; http://n2t.net/addgene:51543 ; RRID:Addgene_51543) -
For your References section:
Integrative Analyses of Human Reprogramming Reveal Dynamic Nature of Induced Pluripotency. Cacchiarelli D, Trapnell C, Ziller MJ, Soumillon M, Cesana M, Karnik R, Donaghey J, Smith ZD, Ratanasirintrawoot S, Zhang X, Ho Sui SJ, Wu Z, Akopian V, Gifford CA, Doench J, Rinn JL, Daley GQ, Meissner A, Lander ES, Mikkelsen TS. Cell. 2015 Jul 16;162(2):412-24. doi: 10.1016/j.cell.2015.06.016. 10.1016/j.cell.2015.06.016 PubMed 26186193