-
PurposeLentiviral plasmid for tet-inducible expression of mouse Oct4, Sox2, Klf4 and Myc for iPS cell generation
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 20321 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneFUW
-
Backbone manufacturerhomemade
- Backbone size w/o insert (bp) 8376
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOct-4
-
Alt nameSox2
-
Alt nameKlf4
-
Alt nameMyc
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)5000
-
Entrez GenePou5f1 (a.k.a. NF-A3, Oct-3, Oct-3/4, Oct-4, Oct3, Oct3/4, Oct4, Otf-3, Otf-4, Otf3, Otf3-rs7, Otf3g, Otf4)
-
Entrez GeneSox2 (a.k.a. Sox-2, lcc, ysb)
-
Entrez GeneKlf4 (a.k.a. EZF, Gklf, Zie)
-
Entrez GeneMyc (a.k.a. Myc2, Niard, Nird, bHLHe39)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ACTTTGCAGCCTGAGGGCCA (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid has an extra XhoI site upstream of the TRE element. You can find the additional XhoI site in Addgene's sequence with mOct4-R primer. Please view Addgene's test digest with XhoI for the correct band pattern.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TetO-FUW-OSKM was a gift from Rudolf Jaenisch (Addgene plasmid # 20321 ; http://n2t.net/addgene:20321 ; RRID:Addgene_20321) -
For your References section:
Reprogramming of murine and human somatic cells using a single polycistronic vector. Carey BW, Markoulaki S, Hanna J, Saha K, Gao Q, Mitalipova M, Jaenisch R. Proc Natl Acad Sci U S A. 2009 Jan 6. 106(1):157-62. 10.1073/pnas.0811426106 PubMed 19109433