pQcre1
(Plasmid #135659)

• Purpose: Clostridial vector, encoding the Cre protein, which mediates recombination between lox sites.
• Depositing Lab: Andrew Tolonen
• Publication: Cerisy et al mSphere. 2019 Dec 11;4(6). pii: 4/6/e00710-19. doi: 10.1128/mSphere.00710-19.

Backbone

• Vector backbone: pAT19
• Backbone size w/o insert (bp): 6500
• Total vector size (bp): 7752
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Erythromycin, 200 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Cre recombinase
• Alt name: Cre
• Species: P1 phage
• Insert Size (bp): 1032
• GenBank ID: YP_006472.1
• Promoter: ppag promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CTTCCGGCTCGTATGTTGTG
• 3′ sequencing primer: TACATCACCGACGAGCAAGG

Resource Information

• Supplemental Documents:
  • pQcre1_Addgene_135659.gbk
• A portion of this plasmid was derived from a plasmid made by: Cre expression cassette cloned from pRAB1 provided by Dr. Ralph Bertram and Christopher F. Schuster

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Cre protein under the control of the gram + PpagA promoter.

Leibig M, Krismer B, Kolb M, Friede A, Götz F, Bertram R. 2008. Marker removal in staphylococci via Cre recombinase and different lox sites. Appl Environ Microbiol 74:1316– 1323.