...combined with site specific recombinase technology like Cre-lox, which allows you to express an opsin ONLY in...using a viral vector with a floxed opsin in a VGAT-cre animal will result in expression of the opsin only...Alternatively, when one half of a given protein, such as the Cre recombinase, is fused to Cry2 and the other half .... Novel recombinant adeno-associated viruses for Cre activated and inactivated transgene expression in... include: Increased photocurrent amplitude Examples: ChR2(H134R), C1V1(t/t), ChIEF Increased channel (... following enhancements: Increased light sensitivity Example: ArchT Increased photocurrent amplitude Examples...Scherffelia dubia ). Synthetic variants have been created via genetic point mutations, codon optimization...

...early promoter, forward primer CRE-R GCAAACGGACAGAAGCATTT 5' end of Cre recombinase, reverse primer CYC1...

... FLEx vectors block expression in the absence of Cre and are especially useful in AAV experiments where...reporter remains silent until a cell or tissue-specific Cre is provided. Want to know more about FLEx vectors...G-protein and activate neuronal signalling by increasing intracellular cAMP concentrations. There is currently... currently one Gs-DREADD, rM3D, that was created by replacing the corresponding intracellular region of...(R165L) Human M3 muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima...hM3Dq hM1Dq hM5Dq Human M3 muscarinic G αq CNO* Increase Ca 2+ Neuronal burst firing Armbruster et al, ...M3 muscarinic & turkey β1-adrenergic G αs CNO* Increase cAMP Neuronal burst firing Guettier et al, 2009...

...used for large scale edits. These proteins, like Cre recombinase or phage derived serine integrases, insert... GAT; increase nuclease fidelity SpCas9-NG - NG; increase in vitro activity SpG - NGN; increase nuclease...others work to increase Cas9’s proofreading capabilities. No matter the method, increased fidelity enzymes...backbone HypaCas9 - increase Cas9 proofreading and discrimination evoCas9 - decrease off-target effects...domains to expand PAM recognition, increase specificity, and decrease off-target effects Sniper-Cas9 - ...compatible with truncated gRNAs to increase specificity SuperFi-Cas9 - increases fidelity with reduced nuclease...integration of donor DNA. Genome-Wide Screens Using CRISPR In a genetic screen, a population of cells with mutations...

...Negative Screen Negative screens are a little trickier than positive screens. In a negative screen, the goal...plasmid. Library screens can be divided into two types: positive screens and negative screens. Both types ...reproducibility. Types of Pooled Library Screens In pooled library screens, cells are infected at a very low ... cells. DIVERGE: Positive and negative screens POSITIVE screen: Apply library Apply selection Most cells... of the selection mechanism Positive Screen In a positive screen, the goal is to identify those cells ...been depleted by selection. In a CRISPR screen, negative screens are often used to identify genes that ...Knockout Screening Pooled CRISPR Libraries Offer Genome-Wide Control for Large-Scale Functional Screens New...

...mutant allele of a gene ( point mutant )? Increase or decrease expression of a target gene? Once you have...High-fidelity Cas enzymes increase specificity. Dual-nickase approach increases specificity but is less ...efficiency. In fact, cleavage efficiency may increase or decrease depending upon the specific nucleotides ...alone for mammalian cell lines. Activate (CRISPRa) Increase expression of an endogenous gene(s) without permanently...vivo A common choice for conducting genome-wide screens using CRISPR AAV transduction CRISPR elements are...Transient expression of CRISPR components Expression decreases as RNA is degraded within the cell Short window...window of CRISPR component expression may decrease off-target effects Can be used to generate transgenic ...

...the gap created by the 5’ exonuclease and finally ligase seals the nicks in the DNA to create one piece...Cloning Oligo Stitching Molecular cloning or the creation of recombinant DNA is an essential process used...several of the most popular cloning methods used to create recombinant DNA. Restriction Enzyme Cloning Restriction...compatible attP sites via a proprietary BP clonase (creating an entry clone). The entry clone now has recombined...restriction enzymes or an exogenous ligase providing an incredibly quick and easy way to clone a fresh PCR product...available TOPO® ready, and it is not feasible to create a TOPO® vector yourself. Additionally, the efficiency...distal to their recognition site allows for the creation of custom overhangs, which is not possible with...

...chance of recombination events creating replication-competent virus increases with each round of amplification... cell lines creates a wildtype adenovirus. The probability of a crossover event increases with each round...Vogelstein , is by far the most popular method for creating adenoviral vector constructs. The system consists... recombinant plasmid is linearized with PacI to create a linear dsDNA construct flanked by ITRs. 293 or...especially long transgenes, the use of pAdEasy-2 can increase the capacity of the adenoviral vector. pAdEasy...transfected cell line (either 293 or 911). To avoid creating replication competent virus, you should not serially...Non-essential gene involved in immune evasion, deleted to increase packaging capacity E4 Essential for viral transcription...

... cell cultures using hybridomas, cell cultures created by fusing B cells with myeloma cells (immortalized...immortalized B cells). The genetic reorganization that creates variety in the antibody allowing for their extreme...animals immunized as described above are used to create hybridomas, which produce large amounts of a single...recombinant antibodies. Recombinant antibodies are created by cloning antibody genes from specific hybridoma...goes through a randomized reorganization process, creating a unique binding site. This process, known as ...roles in the immune response, and can be used to increase flexibility or specificity in antibody-based methods... Valency Subclasses IgA Prevalent antibody in secretions (e.g. tears, saliva, mucus) where it protects...

...be included in transfer plasmids include: Tet- or Cre-based regulation and fluorescent fusions or reporters...FAQ References Glossary Lentiviral Components To increase the safety of lentivirus, the components necessary...transfection with four separate plasmids in order to create functional lentiviral particles. IMPORTANT : A ...and those cells that survive can be expanded to create stable cell lines, which have incorporated the ... recognition site for proviral DNA synthesis. Increases transduction efficiency and transgene expression...that stimulates the expression of transgenes via increased nuclear export. LTR Sub-components: U3 R Sub-element...

...capacity of AAV to 2.4 kb. Methods to Increase Packaging Capacity: To increase the packaging capacity of AAV,...Liver AAV7, AAV8, AAV9 Lung AAV4, AAV5, AAV6, AAV9 Pancreas AAV6, AAV8 Photoreceptor Cells AAV2, AAV5, AAV8...of capsids/ITRs from different AAV serotypes to create hybrid viruses with new properties. Other system...single AAV virus (∼5%). Another technique for increasing packaging capacity depends on homologous recombination...

...study DNA fragments of interest, such as genes. Creation of recombinant DNA Molecular Cloning Plasmids ... With current cloning technology, it is easy to create and modify plasmids containing the genetic element...vector can also include an enhancer sequence which increases the amount of protein or RNA produced. Expression...into target cells. You can use these plasmids to create viral particles, such as lentiviral, retroviral...used in place of ampicillin. Preparing Antibiotics Create a stock solution of your antibiotic. Unless otherwise...

... recognition site for proviral DNA synthesis. Increases transduction efficiency and transgene expression...that stimulates the expression of transgenes via increased nuclear export. LTR Subcomponents: U3 R U5 in ...

...Electrophoresis Bacterial Transformation Plasmid Cloning Creating Bacterial Glycerol Stocks Restriction Digests ...

... Science Guides Addgene has created the following guides to help you start learning...

...and how to use pooled libraries in genome-wide screens. Close About Overlay Select Fluorescent Proteins...