We narrowed to 15 results for: tdTomato
-
TypeCollection...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 NOT AVAILABLE YET Cre is coexpressed with tdTomato and Pac (puromycin... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP...
-
Control AAV Preps
TypeCollection...AAV9-X1.1 Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Khakh 50465 pAAV-hSyn-...rg*, PHP.eB Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104...mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB,...Deisseroth 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Feng 27056...2, 5, 9, rg* Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHP.eB...9, rg* Deisseroth 128434 pAAV-Ef1a-fDIO-tdTomato EF1a tdTomato Flp dependent 1 Jensen 99133 pAAV-CAG-fDIO-mNeonGreen... -
Optogenetics AAV Preps
TypeCollection...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2...Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR...ChrimsonR tdTomato Cre dependent 1, 5 Boyden 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Jensen 174007 pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST...dependent 1, 9 Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1, 5, 8 Boyden 105669... -
Caltech Systemic Capsids
TypeCollection...pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Control...Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 37825 pAAV-CAG-GFP...CamKIIa EGFP Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 83900 pAAV-mDlx-GFP-Fishell...Dimidschstein 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Control Feng 163505 CN1390-rAAV-DLX2.0... -
AAV Molecular Tools
TypeCollection... Activity Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent...Cre-dependent expression of cytoplasmic tdTomato and synaptophysin-EGFP for labeling of axon terminals....terminals. 1 Luo 60658 pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato EF1a-driven, Flp-dependent Flp-dependent expression...Na+ channel mNaChBac and (physically separate) tdTomato 8 Scanziani Tools for Cell Ablation These AAV ... -
Cre-lox system
TypeCollection...AAV Simpson 72255 pCDH-CB-iCre-P2A-tdTomato-T2A-Puro iCre and tdtomato CB Mammalian Oka 72256 pCDH-CB-copGFP-T2A-iCre...Adenoviral Oka 73351 pAdx-CMV-iCre-P2A-tdTomato iCre and tdTomato CMV Adenoviral Oka 73472 RabV CVS-N2c...Insect Rubin 51503 AAV pCAG-FLEX-tdTomato-WPRE Cre dependent TdTomato expression AAV Zeng 60877 pMAZe ...hsp70 Xenopus Ryffel 30525 pBSHSP:Cre;CMV:tdTomato-SceI Cre and tdTomato coexpression Xenopus hsp70 Xenopus... Mammalian Cepko 69916 pAAV.cTNT.iCre iCre and tdtomato Chicken cardiac troponin T AAV Pu 70120 pEMS2159...inserting promoter none Mammalian Heller 112617 ptdTHC tdTomato and Cre-ERT2 with MCS for inserting promoter none...Cre-ERT2 CAG Mammalian Heller 112621 pCAG-tdTHC tdTomato, Cre-ERT2 CAG Mammalian Heller 112622 pVHC_PGKneoLox2DTA... -
Retrograde AAV viral preps
TypeCollection...Cre-dependent Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 50457 pAAV-hSyn-DIO-EGFP ...Flp-dependent Control Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 27056 pAAV-Ef1a-DIO...Optogenetics Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG Activator Optogenetics Svoboda 26975 pAAV-... -
Penn Vector Core Partnership with Addgene
TypeCollection... AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...Wilson AV-5-PV3106 44332-AAV5 pZac2.1 gfaABC1D-tdTomato Control Baljit Khakh AV-8-PV0101 105530-AAV8 pAAV.CMV.PI.EGFP.WPRE.bGH...Wilson AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Optogenetics Scott Sternson AV-1-20071P 20071-...Deisseroth AV-5-PV2510 28305-AAV5 pAAV-FLEX-ArchT-tdTomato Optogenetics Ed Boyden AV-5-PV2527 99039-AAV5 ... Kim AV-10-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-10-PV1963 105542-AAV1 pENN.AAV.CB7...Wilson AV-5-18917P 18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2...Sternson AV-9-18917P 18917-AAV9 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-PV2432 22222-AAV5 AAV-FLEX-Arch-GFP... -
Bacterial Expression Systems
TypeCollection...18084 54856 pBad-mAmetrine1.1 tdTomato-pBAD mAmetrine1.1 (donor) tdTomato (acceptor) FRET/Dual FRET Robert... 54571 54856 mT-Sapphire-pBAD tdTomato-pBAD mT-Sapphire (donor) tdTomato (acceptor) FRET Robert Campbell...Parish 24657 pASTA3 Promoter activity Fluorescence (tdTomato) Mycobacterium sp. Tanya Parish 24658 pCHARGE3... -
Fluorescent Protein Guide: Empty Backbones
TypeCollection... pFA6a-link-tdTomato-SpHis5 - Yeast Expression tdTomato-N1 - Mammalian Expression tdTomato-C1 - Mammalian... Bacterial Expression tdTomato 554 581 95 4.7 1 hr Tandem-dimer pCSCMV:tdTomato - Mammalian Expression...Mammalian Expression tdTomato-pBAD - Bacterial Expression Jump to Top Red Protein Excitation (nm) Emission... -
Fluorescent Protein Guide: Subcellular Localization
TypeCollection...Dorus Gadella 37351 pQC membrane TdTomato IX Membrane Palmitoylation TdTomato Connie Cepko 22479 FUmGW Membrane...118737 pBOB-CARMIL2 BH domain-tdTomato Plasma Membrane CARMIL2 BH domain tdTomato John Cooper *Fusions to other... -
Rett Syndrome
TypeCollection...NLucTom Knock-in of NLuc-tdTomato at endogenous MECP2 locus Castaneus MECP2-NLuc-tdTomato mouse reporter cell... -
CRISPR Plasmids - Empty gRNA Vectors
TypeCollection...Trypanosoma cruzi yes, cut S. pyogenes Neo Docampo tdTomato/pTREX-b 68709 Other/Trypanosoma cruzi none S. ... -
Validated gRNA Sequences
TypeCollection...ATCACAGTGATGCTCGTCAA cut S. pyogenes 26479191 Kim tdtomato Synthetic CGAAATGAGAAAGGGAGCTACAAC 47869 cut N... -
Neurodegeneration Plasmid Collection
TypeCollection... 58112 tdTomato-MAPTau-C-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58113 tdTomato-MAPTau-...TARDBP GFP CMV ALS Zuoshang Xu 28205 wtTDP43tdTOMATOHA TARDBP HA, tdTomato CAG ALS Zuoshang Xu 28206 TDP43 ...tdTomato-MAPTau-N-10 MAPT tdTomato CMV Parkinson's, FTD Michael Davidson 58259 pBabe-Neuroserpin SERPINI1 Dementia Joan...