Skip to main content
Addgene
Showing: 1 - 20 of 33 results

  1. New Viral Vectors - Summer 2024

    Type
    Blog Post
    ...pAAV-Ef1a-fDIO-ChrimsonR-tdTomato AAV9 Controls Jensen New serotype pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA AAV9...multiple serotypes pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] AAV5, AAV8 Optogenetics Boyden New serotypes...

  2. Teaching an Old DOG New Tricks: Controlling Protein Activity with GFP

    Type
    Blog Post
    ...used red fluorescent proteins dsRed, mCherry, and TdTomato do not induce transcription. Thus, T-DDOGs can...expression robustly activated the reporter gene TdTomato, whose expression was absent without electroporated...T-DDOGs with two mouse GFP reporter lines; again, TdTomato was seen only in cells with GFP, at a high activation...frequency of 56-93%. In the converse test, 98% of TdTomato expressing cells were GFP+, indicating a robust...

  3. New and Upcoming Viral Vectors - Spring 2019

    Type
    Blog Post
    ...pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] pAAV-FLEX-tdTomato pAAV-GFAP104-mCherry pAAV-mDlx-NLS-mRuby2 CAG-...fluorescent-tagged molecular tool.   Find pAAV-FLEX-tdTomato, pAAV-GFAP104-mCherry, pAAV-mDlx-NLS-mRuby2, CAG-NLS-GFP... pAAV-hSyn-DIO-mCherry 59462  AAV2  pAAV-CAG-tdTomato (codon diversified) 37825  AAV8*, AAV9*  pAAV-CAG-GFP...

  7. Newly Updated AAV Data Hub!

    Type
    Blog Post
    ...AAV1 Cre virus combined with a Cre-dependent AAV9 tdTomato virus in the mPFC.  The AAV9 is so strong that...

  8. New Viral Vectors - Fall 2024

    Type
    Blog Post
    ...multiple serotypes pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] AAV1 Optogenetics Edward Boyden New serotype ...

  9. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 NOT AVAILABLE YET Cre is coexpressed with tdTomato and Pac (puromycin... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP...

  10. Hot Plasmids - October 2022

    Type
    Blog Post
    ... cations. B) Cortical slice of HcKCR1-EYFP and tdTomato expressed layer 2/3 neurons in mouse. C) Action...

  12. Control AAV Preps

    Type
    Collection
    ...AAV9-X1.1 Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Khakh 50465 pAAV-hSyn-...rg*, PHP.eB Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104...mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB,...Deisseroth 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Feng 27056...2, 5, 9, rg* Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHP.eB...9, rg* Deisseroth 128434 pAAV-Ef1a-fDIO-tdTomato EF1a tdTomato Flp dependent 1 Jensen 99133 pAAV-CAG-fDIO-mNeonGreen...

  13. Optogenetics AAV Preps

    Type
    Collection
    ...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2...Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR...ChrimsonR tdTomato Cre dependent 1, 5 Boyden 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Jensen 174007 pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST...dependent 1, 9 Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1, 5, 8 Boyden 105669...

  14. Caltech Systemic Capsids

    Type
    Collection
    ...pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Control...Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 37825 pAAV-CAG-GFP...CamKIIa EGFP Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 83900 pAAV-mDlx-GFP-Fishell...Dimidschstein 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Control Feng 163505 CN1390-rAAV-DLX2.0...

  15. AAV Molecular Tools

    Type
    Collection
    ... Activity Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent...Cre-dependent expression of cytoplasmic tdTomato and synaptophysin-EGFP for labeling of axon terminals....terminals. 1 Luo 60658 pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato EF1a-driven, Flp-dependent Flp-dependent expression...Na+ channel mNaChBac and (physically separate) tdTomato 8 Scanziani Tools for Cell Ablation These AAV ...

  16. Sequencing Primers

    Type
    Guide
    ...forward primer tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT...TCTTTGATGACGGCCATGT 5' end of tdTomato, reverse primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance...

  18. Cre-lox system

    Type
    Collection
    ...AAV Simpson 72255 pCDH-CB-iCre-P2A-tdTomato-T2A-Puro iCre and tdtomato CB Mammalian Oka 72256 pCDH-CB-copGFP-T2A-iCre...Adenoviral Oka 73351 pAdx-CMV-iCre-P2A-tdTomato iCre and tdTomato CMV Adenoviral Oka 73472 RabV CVS-N2c...Insect Rubin 51503 AAV pCAG-FLEX-tdTomato-WPRE Cre dependent TdTomato expression AAV Zeng 60877 pMAZe ...hsp70 Xenopus Ryffel 30525 pBSHSP:Cre;CMV:tdTomato-SceI Cre and tdTomato coexpression Xenopus hsp70 Xenopus... Mammalian Cepko 69916 pAAV.cTNT.iCre iCre and tdtomato Chicken cardiac troponin T AAV Pu 70120 pEMS2159...inserting promoter none Mammalian Heller 112617 ptdTHC tdTomato and Cre-ERT2 with MCS for inserting promoter none...Cre-ERT2 CAG Mammalian Heller 112621 pCAG-tdTHC tdTomato, Cre-ERT2 CAG Mammalian Heller 112622 pVHC_PGKneoLox2DTA...

  20. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ... AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng AV-9-ALL864 51503-AAV9 AAV pCAG-FLEX-tdTomato-WPRE Hongkui Zeng...Wilson AV-5-PV3106 44332-AAV5 pZac2.1 gfaABC1D-tdTomato Baljit Khakh AV-8-PV0101 105530-AAV8 pAAV.CMV....Optogenetics AV-1-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-1-20071P 20071-AAV1 pACAGW-ChR2...Deisseroth AV-5-PV2510 28305-AAV5 pAAV-FLEX-ArchT-tdTomato Ed Boyden AV-5-PV2527 99039-AAV5 pAAV-CamKII-ArchT-GFP... Kim AV-10-18917P 18917-AAV1 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-10-PV1963 105542-AAV1 pENN.AAV.CB7...Wilson AV-5-18917P 18917-AAV5 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-20071P 20071-AAV5 pACAGW-ChR2...Sternson AV-9-18917P 18917-AAV9 AAV-FLEX-rev-ChR2-tdtomato Scott Sternson AV-5-PV2432 22222-AAV5 AAV-FLEX-Arch-GFP...
Showing: 1 - 20 of 33 results