We narrowed to 33 results for: tdTomato
-
TypeBlog Post...pAAV-Ef1a-fDIO-ChrimsonR-tdTomato AAV9 Controls Jensen New serotype pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA AAV9...multiple serotypes pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] AAV5, AAV8 Optogenetics Boyden New serotypes...
-
Teaching an Old DOG New Tricks: Controlling Protein Activity with GFP
TypeBlog Post...used red fluorescent proteins dsRed, mCherry, and TdTomato do not induce transcription. Thus, T-DDOGs can...expression robustly activated the reporter gene TdTomato, whose expression was absent without electroporated...T-DDOGs with two mouse GFP reporter lines; again, TdTomato was seen only in cells with GFP, at a high activation...frequency of 56-93%. In the converse test, 98% of TdTomato expressing cells were GFP+, indicating a robust... -
New and Upcoming Viral Vectors - Spring 2019
TypeBlog Post...pAAV-Syn-FLEX-rc [Archon1-KGC-GFP-ER2] pAAV-FLEX-tdTomato pAAV-GFAP104-mCherry pAAV-mDlx-NLS-mRuby2 CAG-...fluorescent-tagged molecular tool. Find pAAV-FLEX-tdTomato, pAAV-GFAP104-mCherry, pAAV-mDlx-NLS-mRuby2, CAG-NLS-GFP... pAAV-hSyn-DIO-mCherry 59462 AAV2 pAAV-CAG-tdTomato (codon diversified) 37825 AAV8*, AAV9* pAAV-CAG-GFP... -
Genetically-encoded Sparse Cell Labeling - A SPARC of Innovation
TypeBlog Post...CsChrimson::tdTomato, an optogenetic tool (CsChrimson) attached to a fluorescent indicator (tdTomato), as the... -
Announcing the Winners of the 2021 Michael Davidson and Roger Tsien Commemorative Conference Awards
TypeBlog Post...tag neurons activated by opioid withdrawal with tdTomato and assessed cFos expression. She will explore...periaqueductal gray (PAG), with red neurons expressing tdTomato and green neurons expressing cFos. Image from ... -
Hot Plasmids and Viral Preps - May 2021
TypeBlog Post...targeted tdTomato and pre-synaptic targeted synaptophysin tagged eGFP. AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE... -
Newly Updated AAV Data Hub!
TypeBlog Post...AAV1 Cre virus combined with a Cre-dependent AAV9 tdTomato virus in the mPFC. The AAV9 is so strong that... -
New Viral Vectors - Fall 2024
TypeBlog Post...multiple serotypes pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] AAV1 Optogenetics Edward Boyden New serotype ... -
New Viral Vectors - Winter 2025
TypeBlog Post...Roth New serotype pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato AAV8 Molecular tool Massimo Scanziani New viral... -
Hot Plasmids - October 2022
TypeBlog Post... cations. B) Cortical slice of HcKCR1-EYFP and tdTomato expressed layer 2/3 neurons in mouse. C) Action... -
Kazuhiro Oka Lentiviral Vectors
TypeCollection...pAdx-CMV-iCre-P2A-tdTomato 73351 Expresses iCre and tdTomato from the CMV promoter pAdxEF1-FLPe-tdTomato 73352 Expresses...expressed by another vector pCDH-EF1-DIO-tdTomato 72254 Expresses tdTomato under EF-1 promoter when Cre is expressed...pCDH-CB-iCre-P2A-tdTomato-T2A-Puro 72255 NOT AVAILABLE YET Cre is coexpressed with tdTomato and Pac (puromycin... CB promoter pCDH-CB-FLPe-P2A-tdTomato 72259 Expresses FLPe and tdTomato from the CB promoter pCDH-EF1...expressed by another vector pCDH-EF1-Fon-tdTomato 72261 Expresses tdTomato from the EF1 promoter when FLP is ...EF1 promoter pCDH-EF1-Luc2-P2A-tdTomato 72486 Expresses Luc2 and tdTomato from the EF1 promoter pLL3.7-...copGFP from the CMV promoter pAdx-CMV-tdTomato 73347 Expresses tdTomato from the CMV promoter pAdx-CMV-YFP... -
New and Upcoming Viral Vectors - June 2019
TypeBlog Post...37825 AAV1 pAAV-CAG-GFP 59462 AAV2 pAAV-CAG-tdTomato (codon diversified) 114472 AAV5, AAV8 pAAV-... -
Control AAV Preps
TypeCollection...AAV9-X1.1 Boyden 44332 pZac2.1 gfaABC1D-tdTomato gfaABC1D tdTomato Constitutive 5 Khakh 50465 pAAV-hSyn-...rg*, PHP.eB Roth 51506 AAV phSyn1(S)-tdTomato-WPRE hSyn tdTomato Constitutive 5 Zeng 58909 pAAV-GFAP104...mCherry Constitutive 5 Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB,...Deisseroth 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Constitutive 9, PHP.eB Feng 27056...2, 5, 9, rg* Deisseroth 28306 pAAV-FLEX-tdTomato CAG tdTomato Cre dependent 1, 2, 5, 8, 9, rg*, PHP.eB...9, rg* Deisseroth 128434 pAAV-Ef1a-fDIO-tdTomato EF1a tdTomato Flp dependent 1 Jensen 99133 pAAV-CAG-fDIO-mNeonGreen... -
Optogenetics AAV Preps
TypeCollection...Deisseroth 28017 AAV-CAG-hChR2-H134R-tdTomato CAG ChR2/H134R tdTomato Constitutive rg* Svoboda 75470 pAAV-CAG-FLEXFRT-ChR2...Syn ChrimsonR tdTomato Constitutive 1, 5, 9 Boyden 62723 pAAV-Syn-FLEX-rc[ChrimsonR-tdTomato] Syn ChrimsonR...ChrimsonR tdTomato Cre dependent 1, 5 Boyden 130909 AAV-CAG-FLPX-rc [ChrimsonR-tdTomato] CAG ChrimsonR tdTomato...Deisseroth 171027 pAAV-Ef1a-fDIO-ChrimsonR-tdTomato EF1a ChrimsonR tdTomato Flp dependent 1, 9 Jensen 174007 pAAV-hSyn-DIO-jGCaMP8s-P2A-ChrimsonR-ST...dependent 1, 9 Boyden 28305 pAAV-FLEX-ArchT-tdTomato CAG ArchT tdTomato Cre dependent 5 Boyden 99039 pAAV-CamKII-ArchT-GFP...Boyden 84446 pAAV-CAG-FLEX-rc [Jaws-KGC-tdTomato-ER2] CAG Jaws tdTomato Cre dependent 1, 5, 8 Boyden 105669... -
Sequencing Primers
TypeGuide...forward primer tdTomato-Fwd CTGTTCCTGTACGGCATGG 3' end of tdTomato, forward primer tdTomato-Rev TCTTTGATGACGGCCATGT...TCTTTGATGACGGCCATGT 5' end of tdTomato, reverse primer Tet-R GGCGAGTTTACGGGTTGTTA 5' end of tetracycline resistance... -
Caltech Systemic Capsids
TypeCollection...pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 59462 pAAV-CAG-tdTomato CAG tdTomato Control...Description Category PI Controls 28306 pAAV-FLEX-tdTomato CAG tdTomato, Cre-dependent Control Boyden 37825 pAAV-CAG-GFP...CamKIIa EGFP Control Roth 59462 pAAV-CAG-tdTomato CAG tdTomato Control Boyden 83900 pAAV-mDlx-GFP-Fishell...Dimidschstein 192552 pAAV-CAG-2xNLS-tdTomato-WPRE-hGHpolyA CAG tdTomato Control Feng 163505 CN1390-rAAV-DLX2.0... -
Hot Plasmids and Viral Preps - March 2021
TypeBlog Post...are available for dual expression of cytoplasmic-tdTomato and Synaptophysin-GFP. Synapse targeting GCaMP6s... -
AAV Molecular Tools
TypeCollection... Activity Serotype PI 51509 AAV phSyn1(S)-FLEX-tdTomato-T2A-SypEGFP-WPRE Syn-driven, Cre-dependent Cre-dependent...Cre-dependent expression of cytoplasmic tdTomato and synaptophysin-EGFP for labeling of axon terminals....terminals. 1 Luo 60658 pAAV-EF1α-F-FLEX-mNaChBac-T2A-tdTomato EF1a-driven, Flp-dependent Flp-dependent expression...Na+ channel mNaChBac and (physically separate) tdTomato 8 Scanziani Tools for Cell Ablation These AAV ... -
Cre-lox system
TypeCollection...AAV Simpson 72255 pCDH-CB-iCre-P2A-tdTomato-T2A-Puro iCre and tdtomato CB Mammalian Oka 72256 pCDH-CB-copGFP-T2A-iCre...Adenoviral Oka 73351 pAdx-CMV-iCre-P2A-tdTomato iCre and tdTomato CMV Adenoviral Oka 73472 RabV CVS-N2c...Insect Rubin 51503 AAV pCAG-FLEX-tdTomato-WPRE Cre dependent TdTomato expression AAV Zeng 60877 pMAZe ...hsp70 Xenopus Ryffel 30525 pBSHSP:Cre;CMV:tdTomato-SceI Cre and tdTomato coexpression Xenopus hsp70 Xenopus... Mammalian Cepko 69916 pAAV.cTNT.iCre iCre and tdtomato Chicken cardiac troponin T AAV Pu 70120 pEMS2159...inserting promoter none Mammalian Heller 112617 ptdTHC tdTomato and Cre-ERT2 with MCS for inserting promoter none...Cre-ERT2 CAG Mammalian Heller 112621 pCAG-tdTHC tdTomato, Cre-ERT2 CAG Mammalian Heller 112622 pVHC_PGKneoLox2DTA... -
Neuronal labeling with Spaghetti Monster
TypeBlog Post...usually provided by red fluorescent proteins such as tdTomato or RFP or blue fluorescent proteins like Cyan....