...state using a cocktail of factors (Oct3/4, Sox2, c-Myc, and Klf4) that are known to maintain pluripotency...Doxycycline-inducible expression of human Oct4, Sox2, Klf4, and c-Myc from four separate lentiviral plasmids A drug-inducible...for the expression of human Oct4, Klf4, Sox2, and c-Myc Human Induced Pluripotent Stem Cells Produced Under... vector for the expression of human Oct4, Klf4, c-Myc, and Sox2 Integrative Analyses of Human Reprogramming...Lentivirus Human Expression of human Klf4, Oct4, c-Myc, and Sox2 as VP-16 transcriptional activating fusions...polycistronic expression of human Oct4, Klf4, Sox2, c-Myc and hairpin RNA p53 for single plasmid reprogramming...retroviral expression of human Sox2, Oct3/4, Klf4, and c-Myc from four separate plasmids Induction of pluripotent...

...pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc Early ...pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc Recycling...-RFP-C-h-Rab11a-c-Myc Recycling endosomes Rab11a TagRFP James Johnson 79805 pTag-BFP-C-h-Rab11a-c-Myc ...pCMV-mGold-Tubulin-C-18 Microtubules alpha-tubulin mGold Francois St-Pierre 158009 pCMV-mGold-Actin-C-18 Actin ... NLS mKalama1 Robert Campbell 73205 pcDNA3.1-NLS-myc-dL5-2xG4S-mCer3 Nucleus NLS (from Mak16p protein)...p63 mTurquoise2 Dorus Gadella 73206 pcDNA3.1-kappa-myc-dL5-2xG4S-TMst Cell surface (mammalian) PDGFR-derived...SKL mNeonGreen Dorus Gadella 73210 pcDNA3.1-KozATG-myc-dL5-2XG4S-mCer3-SKL Peroxisome SKL tripeptide, peroxisome...

... C-terminal 3xHA tag for yeast expression Myc Epitope Tag pKMyc - N-terminal Myc ...#834 - C-terminal GST for C elegans expression GFP Localization pcDNA3-EGFP - C-terminal...expression 6xHis Epitope Tag pEZYmyc-His - C-terminal Myc-His tag for mammalian expression...Nuclear Localization pENTR4-myc-nuc - pEntry vector that adds a C-terminal nuclear localization...expression pET GFP - C-terminal GFP for bacterial expression pPD95_75 - C-terminal GFP ...SP6 promoter pCS2 mt-GFP - Create myc-tag, GFP-tag fusions for transcription pCSDest - ...transgenes Worm unc-54, variety of worm gene promoters C. elegans vector kit - Collection of...

...pCMVTNT PINK1 N-myc PINK1 Myc CMV Parkinson's Mark Cookson 13314 pCMVTNT PINK1 C-myc PINK1 Myc CMV Parkinson's...Ultra-Exon1Q23-Myc-A HTT Myc UbC Huntington's Baoji Xu 110487 Ultra-Exon1Q145-Myc-A HTT Myc UbC Huntington's...pUltra-Exon1Q23-Myc-B HTT Myc UbC Huntington's Baoji Xu 110489 pUltra-Exon1Q145-Myc-B HTT Myc UbC Huntington's...Strep-Lrrk2-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161583 pPuro3.1(+)_Strep-Lrrk2-Myc LRRK2 Myc, Strep...LRRK2-WT LRRK2 His, Myc CMV Parkinson's Ted Dawson 17612 pRK5-Myc-Parkin PRKN Myc CMV Parkinson's Ted ... pGW1-Myc-DJ1-WT PARK7 V5 CMV Parkinson's Mark Cookson 29349 pGW1-Myc-DJ1-L166P/K130R PARK7 Myc CMV Parkinson's...D1994S)-Myc LRRK2 Myc, Strep CMV Parkinson's Maik Hintze 161585 pPuro3.1(+)_Strep-Lrrk2(G2019S)-Myc LRRK2...

...including transcriptional reporters for NF-kb, TGF-b, c-Myc, p53 and MAPK/JNK transcriptional reporters Koen...Mammalian expression of Nanoluc with a N-terminal Myc tag Erich Wanker 124701 pLenti-PGK-Venus-Akaluc (...Lentiviral expression of Nanoluc with a N-terminal Myc tag Erich Wanker 115352 pFL-SV40 Firefly SV40 Mammalian...pathway in vivo . DULIP ( DU al L uminescence-based C o- I mmunoprecipitation) plasmids : Luminescence-based...fusing NanoLuc® and Venus fluorophore to Troponin C Ca 2+ binding domain. Nano-lanterns , Enhanced Nano-lanterns...87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning. Lentival...Taipale 87065 pcDNA3.1-ccdB-Renilla Renilla Creation of C-terminal Renilla luciferase fusions using Gateway ...

... mammalian) Tags (e.g. 6xHis, Flag, StrepII, HA, Myc, SUMO, GST, MBP, CBP, S-tag, TAP tag, TRX, or V5)...SARS-CoV-2 genes in E. coli vectors with various N- and C-terminal tags for protein expression and/or purification...-2 genes in yeast expression vectors with various C-terminal tags for protein expression and/or purification... mammalian expression vectors with various N- and C-terminal tags for protein expression and/or purification...

...Cepko 13779 pRho-Cre Cre-Myc rhodopsin Mammalian Cepko 13780 pNrl-Cre Cre-Myc, Expressed in rod photorecetor...recombinant Cre Bacterial Rajewsky 13775 pCAG-Cre Cre-Myc CAG Mammalian Cepko 13776 pCAG-Cre:GFP Cre-GFP fusion... Cre: Cre recombinase is split in half into N and C terminal Cre fragments (NCre and CCre, respectively...Bacterial Ekker 47551 pDD104 (Peft-3::Cre) Cre eft-3 C. elegans Goldstein 48201 CAG-GFP-IRES-CRE Cre and ...system CAG Mammalian Pelczar 51268 pCAG-Co-InCreC C-terminal component of the Co-InCre system CAG Mammalian...GFP (CRE-DOG) EF-1 alpha AAV Cepko 69571 pAAV-EF1a-C-CreintG Cre recombinase dependent on GFP (CRE-DOG)...dependent on GFP (CRE-DOG) CAG Mammalian Cepko 69573 pCAG-C-CreintG Cre recombinase dependent on GFP (CRE-DOG)...

...3rd 4 78,637 Broad GPP Humagne Set C and Humagne Set D 172650 (Set C) 172651 (Set D) Knockout Human Doench...Knockout Library 171531 Knockout Human Li 3rd ~6 9,274 MYC-CRISPR Library 173195 Knockout Human Dzikiewicz-Krawczyk...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...pneumoniae M. tuberculosis M. smegmatis Green monkey ( C. sabaeus ) Kaposi's Sarcoma-associated Herpes Virus...1000000074 (Puromycin) Activation Human Zhang 3rd 3 70,290 SAM v1 - 3 plasmid system 1000000075 (Puromycin) Activation...Library 159391 Knockout Mouse Moffat 3rd 4 182 Mycobacterium tuberculosis CRISPRi Library (RLC12) 163954 ...Inhibition M. tuberculosis Rock NA Varies 96,700 Mycobacterium smegmatis CRISPRi Library (RLC11) 163955 Inhibition...

...: 95 °C for 15 min, 35 cycles of (95 °C for 30 sec, 60 °C for 1 min, 72 °C for 1 min), and 72 °C for 10...following parameters: 37 °C for 30 min; 95 °C for 5 min and then ramp down to 25 °C at 5 °C/min. Dilute oligos...parameters: Cycles 1-20 (37 °C for 5 min, 20 °C for 5 min); Cycle 21 (80 °C for 20 min). These cycling ...Incubate at 30 - 37 °C for 24 - 72 hr. 30 °C may enhance genome editing efficiency, but 37 °C is acceptable....cells to incubate at 37 °C for 3 - 7 days and allow the clones to incubate at 37 °C for 7 - 14 days. Vary...thermocycler and run the following program: 65 °C for 6 min, 98 °C for 2 min to extract gDNA. Measure the DNA...clones. Run sample in thermocycler: 65 °C for 6 min and 98 °C for 2 min to extract gDNA. Screen each clone...

...Yamamoto avr-14 C. elegans GATTGGAGAGTTAGACCACG 58981 cut S. pyogenes 24879462 Mello avr-15 C. elegans GTTTGCAATATAAGTCACCC...Katic dpy-10 C. elegans GCTACCATAGGCACCACGAG 59933 cut S. pyogenes 25161212 Fire dpy-10 C. elegans TCCGCTACCATAGGCACCA...Joung fbf-2 C. elegans GTAGTCACGGCGATGATTA 65597 cut S. pyogenes 25249454 Seydoux fbf-2 C. elegans TAATCATCGCCGTGACTAC...Sabatini K08F4.2 C. elegans AATCACTCCCTGTTTGTGT 66085 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans CACGAGGTGGTATGCGCAG...Seydoux K08F4.2 C. elegans CGCAGCGGTTTCCAAAATG 66092 cut S. pyogenes 25249454 Seydoux K08F4.2 C. elegans GCCTTAACCCAGAATAAGA...rde-1(D718) C. elegans TGCCATTAACTATGTATGT 59927 cut S. pyogenes 25161212 Fire rde-1(D801) C. elegans GATATTGTAGTCTATCGAGA...24346702 Wolfe sqt-1 C. elegans GGAAGGACATAGTTGTCAT 59935 cut S. pyogenes 25161212 Fire sqt-1 C. elegans TGTGGAGTTGGGGTAGCGT...

...for Tet transregulators. Krueger C, Pfleiderer K, Hillen W, Berens C. Biotechniques . 2004 Oct;37(4):546...developed. tTA was created by fusing tetR with the C-terminal domain of VP16 (virion protein 16), an essential...encoded tetracycline resistance. Hillen W & Berens C. Annu Rev Microbiol. 1994;48:345-69. PubMed . Transcriptional...cells. Yao F, Svensjö T, Winkler T, Lu M, Eriksson C, Eriksson E. Hum Gene Ther . 1998 Sep 1;9(13):1939...biomedical research. Bockamp E, Maringer M, Spangenberg C, Fees S, Fraser S, Eshkind L, Oesch F, Zabel B. Physiol...inducible expression of shRNA; neomycin selection; plasmid 21915 has puromycin selection TetR On Wiederschain...from pCW57.1. rtTA was replaced with tTA, and Puromycin was replaced with Blasticidin selection. Please...

...80 °C. Titer All titering is performed on lentiviral preparations that have been stored at -80 °C and ...Preparations are then aliquoted and stored at -80 °C. Titer Titering is either performed by Addgene or ...Control Mycoplasma The 293T cell line was obtained from Takara, and is routinely tested for mycoplasma contamination... tested for mycoplasma contamination. To date, Addgene has never had a case of mycoplasma contamination...contamination using mycoplasma detection kits. The cell line is maintained for ~20 passages before being...

...Currently supports: Drosophila, Arabidopsis, zebrafish, C. elegans, mouse, human, rat, cow, dog, pig, Thale ...coli, B. subtilis ), yeast ( S. cerevisiae ), worm ( C. elegans ), fruit fly, zebrafish, mouse, rat, and ..., and HDR. Reference genomes include Arabidopsis, C. elegans , sea squirt, cavefish, Chinese hamster, ...and X. laevis), zebrafish, sea squirt, Drosophila, C. elegans, Arabidopsis, rice, sorghum, silkworm, and...Currently supports: Drosophila, Arabidopsis, zebrafish, C. elegans, mouse, human, rat, rabbit, pig, possum, ...Currently supports: Drosophila, Arabidopsis, zebrafish, C. elegans , mouse, human, rat, yeast, frog, Brachypodium...cloning gRNA cloning vector Retroviral vectors: neomycin (pSIR-neo) , GFP (pSIR-GFP) , DsRed (pSIR-DsRed-Express2...

...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...inducing a DNA break. Cytosine base editors convert C->T (or G->A on the opposite strand) within a small...which is replaced by guanosine to create A->G (or T->C on the opposite strand) mutations. Plasmid Promoter...PAM = NGG) pCRISPR BsaI E. coli, S. pneumoniae Kanamycin none, need Cas9 plasmid Marraffini pCas9 BsaI ...

...pPD95_75 - C-terminal GFP for C. elegans expression pHT101-mCherry - N- or C-terminal mCherry for C. elegans...GFP and/or mCherry, with neomycin cassette Zebrafish, Sea urchin, Xenopus, and C. elegans Hamdoun Lab Plasmids...mNeonGreen 506 517 93 5.7 10 min Monomer pCS2+mNeonGreen-C Cloning Vector - Mammalian Expression Jump to Top ...pmScarlet_C1 - Mammalian Expression pCS2+mScarlet-C Cloning Vector - Mammalian Expression mScarlet-I 569...mCerulean Davidson Lab Plasmids - Includes many N- and C-terminal fluorescent proteins Insect Sutherland Lab...tagging with mCherry, mOrange, mCerulean pET GFP - C-terminal GFP for bacterial expression Davidson Lab...

...Cas9 + Empty sgRNA) 47549 C. elegans yes, cut S. pyogenes Goldstein DR274 42250 C. elegans BsaI none S. pyogenes...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...pyogenes Zhang PX854 62886 Mammalian BbsI yes, cut, C-terminal S. pyogenes Zhang pGuide 64711 Mammalian ...pyogenes Zhang PX852 62884 Mammalian BbsI yes, cut, C-terminal S. pyogenes Zhang PX855 62887 Mammalian BbsI...pyogenes Zhang PX856 62888 Mammalian BbsI yes, activate, C-terminal S. pyogenes Zhang pU6-(BbsI)_CBh-Cas9-T2A-BFP-P2A-Ad4E1B...pyogenes URA3 Wyrick pCRISPomyces-2 61737 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pRB1017 59936...none S. pyogenes Zon pCRISPomyces-1 61736 Bacteria BbsI yes, cut S. pyogenes Apramycin Zhao pMB70 47943 Worm...

...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...inducing a DNA break. Cytosine base editors convert C->T (or G->A on the opposite strand) within a small...which is replaced by guanosine to create A->G (or T->C on the opposite strand) mutations. Plasmid Gene/Insert...1 none As Cpf1 Qi pKEE401 yes, cut S. pyogenes Neomycin Chen Do you have suggestions for other plasmids...

...gRNAs By Species Mammalian Bacteria Drosophila Plant C. elegans Yeast Zebrafish Xenopus CRISPR Resources ...which a reverse transcriptase (RT) is fused to the C terminus of Cas9 H840A nickase. The fusion enzyme ...-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen pPBT-PE2-PuroTK-pegRNA_GG...

... Streptococcus , Streptomyces , and others) Drosophila Plants (monocots and dicots) C. elegans Yeast (...Zebrafish Xenopus References Barrangou R, Fremaux C, Deveau H, Richards M, Boyaval P, Moineau S, Romero...23287718 Dalvai M, Loehr J, Jacquet K, Huard CC, Roques C, Herst P, Côté J, Doyon Y. 2015. A Scalable Genome-Editing-Based...Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann ...

...PKC eta PKC iota PKC theta PKC zeta Protein kinase C Protor Also known as PRR5; proline rich 5 PTEN Phosphatase...Resources The m echanistic or m ammalian t arget o f r apamycin (mTOR) is a key metabolic regulator controlling...threonine kinase 11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1...associated protein 1 mTOR Mechanistic target of rapamycin p53 TP53; tumor protein p53 PDK1 Pyruvate dehydrogenase...10.1016/j.cell.2012.03.017. PubMed PMID: 22500797 . Rapamycin: one drug, many effects. Li J, Kim SG, Blenis ...