... promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA (BD Biosciences) Myc tag, forward primer Neo-F ...transcription termination signal, reverse primer DsRed1-C AGCTGGACATCACCTCCCACAACG (BD Biosciences) 3' end of...elongation factor-1a promoter, forward primer EGFP-C CATGGTCCTGCTGGAGTTCGTG (BD Biosciences) 3' end of ...primer hUBCpro-F TGAAGCTCCGGTTTTGAACT Human Ubiquitin C (UbC) promoter, forward primer IRES-F TGGCTCTCCTCAAGCGTATT... end of neomycin resistance gene, forward primer Neo-R GCCCAGTCATAGCCGAATAG 5' end of neomycin resistance...primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer pZIP TCCTTTCCAGCGAGGTTCTA...

... T H A, C, or T K G or T M A or C N A, T, C, or G R A or G S C or G V A, C, or G W A or T Y C or T Amino...Thymine (T), Cytosine (C) and Guanine (G). In the double helix A always pairs with T and C always pairs with...Adenine C Cytosine G Guanine T Thymine U Uracil Single Letter Code: Ambiguous bases Nucleobase B C, G, or...Acid Sequence FLAG DYKDDDDK HA YPYDVPDYA His HHHHHH Myc EQKLISEEDL V5 GKPIPNPLLGLDST Xpress DLDDDDK or DLYDDDDK...thymine, cytosine, and guanine (abbreviated to A, T, C, and G respectively) that are organized into a double...1000X stock solutions and storing aliquots at -20°C. To use, dilute your antibiotic into your LB medium...complementary, strand. Specifically, A pairs with T and C pairs with G. During replication, DNA unwinds and ...

...Is Mediated by a Central DNA Flap. Zennou V, Petit C, Guetard D, Nerhbass U, Montagnier L, Charneau P. ... genomes have selectable markers, such as the puromycin resistance gene, conferring antibiotic resistance...