Skip to main content
Addgene
Showing: 1 - 20 of 59 results

  1. Immunology Research Plasmids and Resources

    Type
    Collection
    ... Plasmid Collections Immunology Research Immunology Research Plasmids and Resources You...Addgene’s immunology collection contains plasmids for genes involved in innate and adaptive immune signaling...secondary immune response. Browse Plasmids for Immunology Research Genes have been grouped into tables ... ImmPort, toward repurposing of open access immunological assay data for translational and clinical research...

  2. Luciferase Plasmid Collection

    Type
    Collection
    ...Ferrer 87067 pcDNA3.1-ccdB-Nanoluc NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Taipale 87075 pLenti6.2-ccdB-Nanoluc NanoLuc® Creation of C-terminal Nanoluc fusions using Gateway cloning... Taipale 87078 pLenti6.2-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Oskar Laur 87070 pcDNA3.1-Nanoluc-ccdB NanoLuc® Creation of N-terminal Nanoluc fusions using Gateway cloning...Proteins Blog: Luciferase 101 Blog: Technologies Enabled by NanoLuc® Luciferase Blog: Luminescent Imaging...interactions. NanoLuc® complementation : Protein-protein assays based on a split NanoLuc® have been used...141285 pGWB401NL3F10H NanoLuc® Creation of C-terminal luciferase fusions (NanoLuc-3xFLAG-10xHis) using ...

  3. CRISPR Guide

    Type
    Collection
    ...egularly I nterspaced S hort P alindromic R epeat) technologies. Before CRISPR, genome engineering approaches...CRISPR one of the most scalable genome editing technologies, making CRISPR perfect for genome-wide screens...population, you will look for relevant hits using NGS technology. For more detail on using CRISPR libraries for...identified by in vivo screening in yeast. Nature Biotechnology , 36 (3), 265–271. PMID: 29431739 Chen, J. S...CRISPR-Cas nucleases in human cells. Nature Biotechnology , 31 (9), 822–826. PMID: 23792628 Fu, Y., Sander...specificity using truncated guide RNAs. Nature Biotechnology , 32 (3), 279–284. PMID: 24463574 Gao, S., Wang...specificity of RNA-guided Cas9 nucleases. Nature Biotechnology , 31 (9), 827–832. PMID: 23873081 Hu, J. H.,...

  4. TALEN Guide

    Type
    Collection
    ...TALEN technology and using TALEN plasmids... TALENs TALEN Guide Addgene's Guide to TALEN Technologies You ...'s December 2011 Newsletter Overview of TALEN Technology Imagine being able to manipulate a specific region..., zinc finger (ZF) arrays have been the go-to technology for targeting enzymes and other useful protein.... With the template for studying this type of technology already laid by the zinc finger community ( see...Addgene. This kit, first described in Nature Biotechnology in August, uses a serial ligation protocol to...published a paper on TAL effectors in Nature Biotechnology early in 2011 and they described their kit for...

  5. AAVED

    Type
    Collection
    ...this technology is used for targeted neuronal manipulation. Practical tips for using the technology in ...Education and Development (AAVED) Series AAV Technologies and Methods for Targeted Neuronal Manipulation...the guide. We hope that this guide will improve technology adoption and scientific outcomes. Event Details...Cepko 2:45 PM Break 3:00 PM (Group Discussion) Technologies and Resources Missing in the Field Kenton Woodard...presentation is to: Give a general overview of the technology and how it can be used for targeted neuronal ...focused on: Potential combination with other technologies to achieve different experimental goals. How... manipulation? Best practices for using this techonology in the lab (main issues/factors that researchers...

  6. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ... genome-wide screening. CRISPR Technological Advances CRISPR technology development has occurred at a ...various biological and translational technologies. Biotechnology companies are exploring therapeutic applications...applications, eclipsing past genome engineering technologies like zinc finger nucleases (ZFNs) and TALENs...Scientists have also developed CRISPR editing technologies that do not rely on NHEJ or HDR: Base editors... it’s clear that CRISPR is a truly disruptive technology for basic research. The beauty of CRISPR is that...nuclease specificity using truncated guide RNAs. Nat Biotechnol . 32(3):279-84. PMID: 24463574 Fujita T, Fujii...and engineered sgRNAs using CRISPRainbow. Nat Biotechnol . . PMID: 27088723 Makarova KS, Wolf YI, Alkhnbashi...

  7. TALEN Engineering

    Type
    Collection
    ...Zebrafish ( Sander et al., Nat Biotechnol. 2011 ) Rats ( Tesson et al., Nat Biotechnol. 2011 ) Human somatic cells...cells ( Miller et al., Nat Biotechnol. 2011 ; Reyon and Tsai et al., Nat Biotechnol 2012 ) Human pluripotent...Ligation) assembly method (Sander et al., Nat Biotechnol. 2011), the REAL-Fast assembly method (Reyon ...) assembly method (Reyon and Tsai et al., Nat Biotechnol 2012). All three of these platforms assemble ...pluripotent stem cells ( Hockemeyer et al., Nat Biotechnol. 2011 ) TALE transcriptional activators in human cells...

  8. Plasmids for Stem Cell Research

    Type
    Collection
    ...capacity to give rise to an entire organism. iPSC technology removes the possible ethical concerns related...tumorigenicity, an inherent disadvantage of iPS cell technology. Browse Addgene's collection of Transdifferentiation... lineage conversion of acinar cells. Nature Biotechnology. 2014 Dec;32(12):1223-30. Zhou Astrocytes Dopaminergic...oligodendroglial cells by direct lineage conversion. Nat Biotechnol. 2013 May;31(5):434-9. Wernig Fibroblasts Oligodendrocyte...myelinogenic oligodendrocyte progenitor cells. Nat Biotechnol. 2013 May;31(5):426-33. Tesar Fibroblasts Medium...fibroblasts into antigen-presenting dendritic cells. Sci Immunol. 2018 Dec 7;3(30). pii: 3/30/eaau4292. Pereira ...

  9. Lentivirus Plasmids

    Type
    Collection
    ... used with 2nd and 3rd generation lentivirus technologies. ID Plasmid Generation Type Description PI 12253...-G recommended for the FELIX (FIV-based) system Nolan 22502 pCEP4-tat N/A Packaging Expression of tat;... FELIX vector system, expresses Gag-Pol and Rev Nolan 35617 pCAG-Eco N/A Envelope Ecotropic MLV expressing... used with 2nd and 3rd generation lentivirus technologies. Looking for lentiviral plasmids to express ...gene of interest) can be cloned into the plasmid. Nolan 12257 pWPXL 2nd EF-1alpha driven constitutive transgene...

  10. Zhang Lab CRISPR Page

    Type
    Collection
    ...trans-activating crRNA (tracrRNA; Hsu et al ., Nature Biotechnology 2013). We also have an older system using two...express up to three sgRNAs (Swiech et al., Nature Biotechnology 2014). Full references are below. Available ...mouse CRISPR-Cas9 is a versatile genome editing technology for studying the function of genetic elements...Cradick TJ, Marraffini LA, Bao G, Zhang F. Nat Biotechnol. 2013 Sep;31(9):827-32. doi: 10.1038/nbt.2647...Habib N, Li Y, Trombetta J, Sur M, Zhang F. Nat Biotechnol . 2015 Jan;33(1):102-6. doi: 10.1038/nbt.3055...

  11. Validated gRNA Sequences

    Type
    Collection
    ...25619936 Sato NanoLuc synthetic AGCTTACGCCACCCTGTTCC 68897 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...26918244 Lu NanoLuc synthetic TCACGCTCACACCCAGGTTC 68895 interfere S. pyogenes 26918244 Lu NanoLuc synthetic...GAGTGGGAGGGTCCCGTCCT 68060 cut S. pyogenes Fungal Biology and Biotechnology 2015, 2:4 Hong Ctnnb1 M. musculus AGCTCCTTCCCTGAGTGGCA...

  12. New England Biolabs Cell-Imaging Plasmid Collection

    Type
    Collection
    ...England Biolabs Cell-Imaging Plasmid Collection Technology Plasmids Supplemental Information New England...fixed cells. The plasmids associated with this technology are available at Addgene for distribution to ...NEB's comparison of SNAP-tag, CLIP-tag, and GFP . Technology SNAP-tag SNAP-tag is based on the human O6-alkylguanine-DNA-alkyltransferase...

  13. Antibody Plasmid Collection

    Type
    Collection
    ...monoclonal antibody fragments by phage display. J Immunol Methods. 2000 Aug 28;242(1-2):159-81. Carlos Barbas...and utilisation of recombinant antibodies. BMC Biotechnol. 2006 Dec 7;6:46. John McCafferty CRISPR system...selected from Tomlinson I+J phagemid libraries. Immunol Lett. 2015 Oct;167(2):95-102. Joanna Bereta Sybody...

  14. Microbiology Resources

    Type
    Collection
    ...units in the oleaginous yeast Y. lipolytica - Rossignol Lab Yeast Gateway kit : 285 vectors for expression...CRISPR Guide for a general introduction to CRISPR technology. Check out our CRISPR reference page for CRISPR...resources Bacterial CRISPR Resources The CRISPR technology was developed from bacterial immune systems, ...

  15. Plant Plasmids and Resources

    Type
    Collection
    ...spanning a wide variety of molecular biology technologies: from genome engineering and gene regulation...CRISPR Guide for a general introduction to CRISPR technology or the Plant CRISPR Resources for a full selection...initiative promotes interdisciplinary exchange, open technologies, and responsible innovation for improvement ...

  16. Zebrafish Plasmid Collection

    Type
    Collection
    ...CRISPR Guide for a general introduction to CRISPR technology or the zebrafish CRISPR resources for a full ...zebrafish resources and developing new lines and technology. European Zebrafish Resource Center (EZRC) - ...- A repository at the Karlsruhe Institute of Technology (KIT) for the distribution of zebrafish lines ...

  17. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ...2009 (Hoshino & Fujii), the locus-specific ChIP technologies enable us to purify specific genomic regions...interacting with those regions. Locus-specific ChIP technologies consist of insertional chromatin immunoprecipitation...DNA fragments and chromatin by in vitro enChIP technology using recombinant CRISPR ribonucleoproteins. ...

  18. Rett Syndrome

    Type
    Collection
    ... Stem Cell Research page. CRISPR Tools CRISPR technology is a promising therapeutic approach for precise...CRISPR Guide for a general introduction to CRISPR technology or the mammalian CRISPR resources for a full ...Anti-MECP2 (D4F3) rabbit antibody from Cell Signalling Technology Additional Resources (Link opens in a new window...

  19. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...pentose and disaccharide accumulation in bacteria. Biotechnol Biofuels. 2008 Jun 3. 1(1):11. Wolf Frommer Maltose...indicator for in vitro and in vivo studies. Nat Biotechnol. 2018 Sep;36(8):726-737. Yulong Li Acetylcholine...imaging of endocannabinoid dynamics in vivo. Nat Biotechnol. 2021 Nov 11. pii: 10.1038/s41587-021-01074-4...measurements of membrane charges in live cells. Nat Biotechnol. 2017 Mar 13. Katharina Gaus Endo/Exocytosis ...

  20. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...CMV Huntington's Arnold Boersma 175061 pQ39-VC HTT Venus, mCherry CMV Huntington's Arnold Boersma 175062...mCherry CMV Huntington's Arnold Boersma 175064 pQ79 HTT mCherry CMV Huntington's Arnold Boersma 175066 pVC-...mCherry CMV ALS Arnold Boersma 175067 pVC-FUS-R521C FUS Venus, mCherry, HA CMV ALS Arnold Boersma 175068...2A Tau WT WPRE MAPT CBA Parkinson's, FTD Matthew Nolan 138134 pT7NT*-Bri2 113-231 R221E ITM2B NT T7 Familial...175068 pFUS-WT-VC FUS Venus, mCherry, HA CMV ALS Arnold Boersma 175307 pH6HTC_HNRNPA1-Halo HNRNPA1 Halo, His... Arrowsmith 211083 pNLF1-C_EIF2B2:1-351 EIF2B2 NanoLuc CMV VWM, CACH Cheryl Arrowsmith 211112 pBiT3.1-...
Showing: 1 - 20 of 59 results