Skip to main content
Addgene
Showing: 1 - 20 of 26 results
  1. Golden Gate Assembly Upgrades: More Fragments, Faster Assembly, and Higher Fidelity

    Type
    Blog Post
    ...based on the ability to correctly assemble a lacI/lacZ cassette (designed by NEB for use in optimization...coding sequence for beta-galactosidase in the lacI/lacZ cassette. Additional confirmation of accurate assemblies...showed the expected complete sequence for the lacI/lacZ genes (1), while sequencing of white colonies showed...blue phenotype. Indeed, this was seen in all lacI/ lacZ assembly test systems; no blue colonies were obtained...from 1-, 12- and 24-fragment assemblies of the lacI/lacZ cassette, and illustrates how the volume of the ...fidelity and assembly efficiency Five fragment lacI/lacZ cassette assembly was easily achievable with high...both the 12- and 24-fragment versions of the lacI/lacZ cassette were designed and synthesized. In conjunction...
  2. Plasmids 101: Screening Strategies Used in Plasmid Cloning

    Type
    Blog Post
    ...the blue-white screen, which relies on the lacZ gene. lacZ encodes the enzyme š›½-galactosidase which can...screening at Addgene! Some bacterial strains contain lacZ in their genome, and scientists have found that ...gene of interest is inserted into the middle of the lacZ gene, thus disrupting š›½-galactosidase activity....comes in. Letā€™s take a look at All_in_one_CRISPR/Cas9_LacZ, a CRISPR gRNA plasmid from Lynne Postovitā€™s lab...
  3. Plasmids 101: Common Lab E. coli Strains

    Type
    Blog Post
    ...lacIqĀ āˆ†(lacZ)M15 zzf::Tn10Ā (TetR)Ā āˆ†(ara-leu) 7697 araD139 fhuA āˆ†lacX74 galK16 galE15 e14- Ā Ī¦80dlacZāˆ†M15 recA1...overproduced, expression from pLac repressed more Ā  LacZ Ī²-galactosidase activity abolished Ā  lacY Lactose...recA1 relA1 lac glnV44 F'[Ā ::Tn10 proAB+Ā lacIqĀ Ī”(lacZ)M15] hsdR17(rK-Ā mK+)Ā  XL10 Gold Tetracycline and...glnV44 thi-1 recA1 relA1 gyrA96 deoR nupG Ī¦80dlacZĪ”M15 Ī”(lacZYA-argF)U169, hsdR17(rK-Ā mK+), Ī»ā€“ HB101 Streptomycin...Gateway cloning). F-mcrA Ī”(mrr-hsdRMS-mcrBC) Ī¦80lacZĪ”M15 Ī”lacX74Ā recA1Ā araĪ”139 Ī”(ara-leu)7697Ā galUĀ galK...Ā endA1 recA1 galE15 galK16 nupG rpsL Ī”lacX74 Ī¦80lacZĪ”M15 araD139 Ī”(ara,leu)7697 mcrA Ī”(mrr-hsdRMS-mcrBC...mcrB+Ā Ī”(lac-proAB) e14- [F' traD36 proAB+Ā lacIqĀ lacZĪ”M15] hsdR17(rK-mK+) JM110Ā  StreptomycinĀ  For storing...
  4. Plasmids 101: Blue-white Screening

    Type
    Blog Post
    ...that deleting a section from the lacZ gene (a mutation called lacZĪ”M15) creates a non-functional Ī²-galactosidase...well-characterized bacterial lac operon contains a gene called lacZ that encodes for the enzyme Ī²-galactosidase. Expression...section of amino acids (called the Ī±-peptide) to a lacZĪ”M15-mutant bacterial cell in transĀ complements the...use a proper E. coli strainĀ (i.e. contains the lacZĪ”M15 mutation): XL1-Blue, DH5Ī±, DH10B, JM109, STBL4...
  5. The Pleiades Promoter Project

    Type
    Collection
    ...pEMS1492 intron-lacZ/NLS Ple22 CCKBR pEMS1493 intron-lacZ/NLS Ple23 CCKBR pEMS1494 intron-lacZ/NLS Ple24 CCKBR...pEMS1495 intron-lacZ/NLS Ple25 CCKBR pEMS1496 intron-lacZ/NLS Ple26 CCL27 pEMS1497 intron-lacZ/NLS Ple27 CCL27...pEMS1498 intron-lacZ/NLS Ple28 CCL27 pEMS1499 intron-lacZ/NLS Ple29 CCL27 pEMS1500 intron-lacZ/NLS Ple30 CD68...pEMS1504 intron-lacZ/NLS Ple34 CLDN5 pEMS1505 intron-lacZ/NLS Ple35 CLDN5 pEMS1506 intron-lacZ/NLS Ple36 CRH...pEMS1593 intron-lacZ/NLS Ple123 ICMT pEMS1594 intron-lacZ/NLS Ple124 ICMT pEMS1595 intron-lacZ/NLS Ple125 ...pEMS1597 intron-lacZ/NLS Ple129 MKI67 pEMS1600 intron-lacZ/NLS Ple131 MKI67 pEMS1602 intron-lacZ/NLS Ple135...pEMS1650 intron-lacZ/NLS Ple179 RLBP1L2 pEMS1651 intron-lacZ/NLS Ple180 RLBP1L2 pEMS1652 intron-lacZ/NLS Ple181...
  6. dTAG - You're it!

    Type
    Blog Post
    ...expressing a control -- for example, an FKBP12F36V-tagged LACZ) with dTAG molecules in your biological assay of...
  7. Zhang Lab CRISPR Page

    Type
    Collection
    ...template 60225 : control for AAV-KPL; sgRNA targeted to LacZ, plus luciferase-2A-Cre recombinase 60226 : sgRNA..., plus Cre recombinase 60228 : sgRNA targeted to LacZ, plus Cre recombinase 60229 : sgRNA cloning backbone...repair donor template. #60225 - AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR This plasmid contains...luciferase-2A-Cre recombinase and an sgRNA targeted to LacZ, which is not present within the mouse genome. This...NeuN. As a control they designed an sgRNA targeting LacZ, which is not present in the mouse genome. These...to the mouse NeuN gene. #60228 - AAV:ITR-U6-sgRNA(LacZ)-pCBh-Cre-WPRE-hGHpA-ITR This plasmid contains two...cassettes, Cre recombinase and an sgRNA targeted to LacZ, which is not present within the mouse genome. #60229...
  8. Kazuhiro Oka Lentiviral Vectors

    Type
    Collection
    ...Adenoviral Vector ID Purpose pAdx-CMV-LacZ 73345 Expresses lacZ from the CMV promoter, forms blue colonies...-beta actin promoter with CMV enhancer. pAdx-CMV-LacZ is uniquely suited to simplify the cloning process...
  9. Bacterial Expression Systems

    Type
    Collection
    ...Voigt When combined with pCph8 and pPLPCB(S), makes lacZ expression inducible by red light. pCph8 50552 pLtetO...responsive sensor protein that activates expression of lacZ in response to green light. BIOFAB plasmid set 1000000037...containing easily measurable reporter genes (eg. LacZ or Fluorescent Proteins ) under the control of a...Cloned by researcher Fluorescent protein, GUS, and LacZ Derivatives avaliable Philip Poole A family of promoter...protein in pACĪ»CI-Ī²-flap results in the activation of lacZ expression from FW102 OL2-62 . Wolfe Bacterial One-Hybrid...
  10. Sequencing Primers

    Type
    Guide
    ...TGTAAAACGACGGCCAGT In lacZ gene M13 (-40) GTTTTCCCAGTCACGAC In lacZ gene M13 Reverse CAGGAAACAGCTATGAC In lacZ gene M13...' end of LacI, reverse primer LacZ-R GACAGTATCGGCCTCAGGAA 5' end of LacZ, reverse primer LexA CGTCAGCAGAGCTTCACCATTG...(Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene MBP-F GATGAAGCCCTGAAAGACGCGCAG... reverse primer M13 Reverse CAGGAAACAGCTATGAC In lacZ gene MSCV CCCTTGAACCTCCTCGTTCGACC (BD Biosciences...
  11. Worm Expression Resources

    Type
    Collection
    ...set of vectors for C. elegans research, including lacZ and GFP fusion vectors. C. elegans optimized fluorophores...
  12. TALEN Plasmids and Kits

    Type
    Collection
    ...compatibility with the Golden Gate TALEN kit, (ii) a lacZ fragment for blue/white-screening in E.coli , (iii...
  13. Control AAV Preps

    Type
    Collection
    ..., 5, 8, 9, rh10, PHP.eB Wilson 105531 pAAV.CMV.LacZ.bGH CMV LacZ Constitutive 1, 5, 8, 9 Wilson 105532...
Showing: 1 - 20 of 26 results