...fusions for analyzing gene expression in Escherichia coli and yeast. Methods Enzymol. 1983;100:293-308. PubMed...

...Using Francisella Cpf1 (FnCpf1), they employed an E. coli plasmid depletion assay to discover FnCpf1’s PAM...

... High levels of gene expression Promoter from E. coli tryptophan operon Repressible Gets turned off with...

...article 60224 cut S. pyogenes 25263330 Zhang LacZ E. coli TGCGAATACGCCCACGCGAT 60225 cut S. pyogenes 25263330...ACTCCAGTCTTTCTAGAAGA 64216 cut S. pyogenes 25803306 Kuhn rpsL E. coli AAAAAACCGAACTCCGCGCTGCGTAAAGTA 44505 cut S. pyogenes...AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes 26829286 Lu LacZ E.coli CCCGAATCTCTATCGTGCGG 74179 cut S. pyogenes 26627737...

...plasmids. The collection contains: Plasmids for E. coli and Yeast expression Spike protein constructs for...

...transforming a backbone phagemid vector into an E. coli strain that is deficient in dUTPase and uracil deglycosidase...

...construct can be easily expressed and purified from E. coli, retains important functional properties, and is...

...PCR reaction, no ligation is required since the E. coli you transform your PCR products into will efficiently...

...transformed into AdEasier-1 cells , which are BJ5183 E. coli cells containing pAdEasy™. pAdEasy™ is a ∼33Kb adenoviral...for very large inserts AdEasier-1 cells BJ5183 E. coli cells containing the pAdEasy-1 packaging plasmid...

...intron, preventing Cre expression when cloning in E. coli . This alteration enables the generation of a single...construct (unmodified Cre will cause recombination in E. coli , deleting the floxed portion of a construct during...

...post: Synthetic Photobiology: Optogenetics for E. coli. Schmidl, et al. ACS Synth Biol. 2014 Nov 21...aggregation propensity in four expression systems: E. coli, wheat germ, HeLa, and Leishmania (Gagoski, et al... replication increases plasmid copy number in E. coli. The authors used pXPG to study the human GM-CSF... F30-2xdBroccoli are available, as well as 5S RNA F30-2xdBroccoli fusion and pET28c-F30-Broccoli controls...mammalian cells with Broccoli Vegetable tags, including Spinach, Spinach2, and Broccoli, can benefit your...scaffold allows insertion of two dimeric Broccoli tags (2xdBroccoli) to further enhance fluorescence of the...controls. Don’t just eat more broccoli, use Broccoli tags in your experiments too! Filonov, et al. Chem...

... RSMs? In our study (1), we implement RSMs in E. coli with two plasmids (Figure 3 below): Input Plasmid...

...created by directed evolution of the Escherichia coli TadA, a tRNA adenosine deaminase. Like cytosine ...the DNA and replaces it with another base. In E. coli , this strategy yields C to A base edits, whereas...harnessed for antiviral mechanisms in bacteria ( E. coli ). Like the other Cas enzymes, the Cascade-Cas3 .... (2018). Genome-wide CRISPR-dCas9 screens in E. coli identify essential genes and phage host factors....

...recombination persists even in recombinase deficient E. coli and under conditions used to minimize recombination...

...Engineering production of functional scFv antibody in E. coli by co-expressing the molecule chaperone Skp. Front...

...ATGCCATAGCATTTTTATCC (Invitrogen) For vectors with E. coli araBAD promoter, forward primer pBAD Reverse GATTTAATCTGTATCAGG...GATTTAATCTGTATCAGG (Invitrogen) For vectors with E. coli araBAD promoter, reverse primer pBluescriptKS TCGAGGTCGACGGTATC...

...luciferase gene allow for increased copy number in E. coli and expression of luciferase in the cytoplasm of...

...demonstrated in 2005 that proteins fused with E. coli dihydrofolate reductase (eDHFR) could be labeled...

...prime editors with RT domains derived from the E. coli Ec48 retron RT and the S. pombe Tf1 retrotransposon...

...operon trp Repressible by tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter...