...containing the gene of interest (pTet-IRES-EGFP, pPRIME-Tet-GFP-FF3) and one with either tTA or rtTA (FUW-M2rtTA...viral titre to the number of cells transduced by a GFP encoded virus, and the reverse transcriptase activity... as it shows rapid gene expression kinetics as compared to the Tet-off system. One drawback of the Tet...

... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...viral genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, ... prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from Edward Boyden (Addgene viral...Purity Purity of AAV preparations is assayed by comparing the relative stoichiometric ratios of the viral...

... (FLAG, Myc, etc.) and fluorescent protein tags (GFP, mCherry, etc.). Fluorescent tags are primarily used...work best attached to, and the species they are compatible with are all reviewed here. What are affinity...

..., hygromycin) and fluorescent protein reporters (GFP, BFP, RFP, no FP). The vectors each contain two SfiI...efficiencies of stable gene transfer using SB100x were comparable to stable transduction efficiencies of integrating...

...endocytosis of a fluorescent dye and transduction of GFP-expressing AAV particles we did not observe any difference...demonstrate that these results were, in fact, due to impaired endocytosis. In parallel assays designed to test...

...strain transformed with pBLADE expressing superfolder GFP instead of mCherry under the PBAD promoter. They ...What advantages does BLADE have over AraC? When compared to the original AraC system, BLADE is simply more...

...or smaller. Some examples include a reporter like GFP, some smaller CRISPR-Cas proteins such as SaCas9,...secondary structure and high GC content, but some companies now offer Sanger sequencing conditions which can...

... University with David Goldstein’s lab, will use GFP-ATP1A3, FLAG-ATP1A3, and ATP1B3 plasmids to explore...paralysis (hemiplegia) that are often painful and accompanied by migraines. Those attacks can be brought on...

...destination vector contains GFP, enabling you to select cells with high GFP expression. These cells have...Oligonucleotides specifying the gRNA seed sequence should be compatible with type IIS enzyme BfuAI. Gateway cloning is...supply it with another plasmid.   Figure 3: Comparison of Multiplex Strategies including Standard PolIII-gRNA...Cas9-containing binary vectors. The system is compatible with both monocot and dicot plants. Liu Lab Golden...

...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information... available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing...encode fluorescent reporters and can be used to compare the tropism of different serotypes. In addition... 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For...

...collection is now complete! pAAV-CAG-GFP (plasmid 37825) and pAAV-hSyn-EGFP (plasmid 50465) are now available...our entire AAV inventory. Our new AAVs include: EGFP-expressing AAV for serotype testing Calcium sensors... testing AAV, which are small (20 ul) samples of EGFP-expressing AAV packaged in various serotypes. This...recently released these controls: pAAV-hSyn-DIO-EGFP (50457-AAV5): The Synapsin promoter directs broad...broad, neuronal expression. AAV pCAG-FLEX-EGFP-WPRE (51502-AAV5): The CAG promoter directs ubiquitous expression...interneurons. pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5 and 112677-AAVrg): The EF1a promoter...mCherry in the absence of Cre, and expresses nuclear EGFP in the presence of Cre. Biosensor AAV (calcium ...

...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria...

...library comes either with or without mCherry and GFP fluorescent controls. Alternatively, you can order... TF library (aka the MORF Collection) and an accompanying expression atlas, including over 3,500 human...endoderm, and mesoderm). These profiles were then compared to that of reference cell types generated by the...

...be another method to assess transfection success. GFP is often used as a reporter and we will be covering...cells. Of course, these mammalian vectors must be compatible with the cell type they are tranfected into –...called transfection. Transfection is somewhat comparable to bacterial transformation (the introduction...

...the viral protease, Nsp5. Our set also includes a GFP construct as a control. For easier portability, all...the human interactors we found in our map have an impact on virus replication. While we and our collaborators...

...fluorescent protein topics page Get the basics on GFP Find microbiology blog posts Resources on Addgene.org...variant library is monitored by fusing the variants to eGFP followed by an internal ribosomal entry site and...a variant has wild-type levels of abundance, the eGFP will be stable and fluoresce. But if the variant...unstable, it will be degraded, leading to reduced eGFP fluorescence. Cells expressing the library are then...fluorescence-activated cell sorting into four bins based on their eGFP:mCherry ratios. Genomic DNA from each bin are then extracted...and colonization opportunities for bacteria. To compare the artificial leaf to A. thaliana leaf, Bernach...

...via phosphorylation, promoting transcription of a GFP reporter. Subsequent exposure to red light rapidly...expression levels are optimal. These tools are compatible with many strains of E. coli, as well as with...

...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing... FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential patterning of cGMP... vascular smooth muscle cells revealed by single GFP-linked biosensors. Proc Natl Acad Sci U S A. 2008...autophagic flux by pH-sensitive fluorescence (pMRX-IP-GFP-LC3-RFP) An Autophagic Flux Probe that Releases an...

...ones? Many of the available biosensors use a single GFP or CFP/YFP-derived FRET pair. If you need to free..., a neuron subtype) and specific subcellular compartments for measurements. All of the sensors discussed...calcium concentrations in different subcellular compartments can vary greatly. Additionally, the calcium ...susceptible to artifacts and pH interference, and comparison between experiments can be more difficult due...particularly useful sensor for neuroscientists is CaMPARI. This sensor switches from green fluorescence to... of neurons in vivo to study circuit activity. CaMPARI is available for neuron-specific expression (hSyn...expression (CAG promoter). An improved version named CaMPARI2 is available for neuron-specific expression in...

...non-immunogenic violet-excited GFP variant Vex. To understand the impact of this gene editing tool on the...