We narrowed to 164 results for: mPA-GFP
-
TypeBlog Post...containing the gene of interest (pTet-IRES-EGFP, pPRIME-Tet-GFP-FF3) and one with either tTA or rtTA (FUW-M2rtTA...viral titre to the number of cells transduced by a GFP encoded virus, and the reverse transcriptase activity... as it shows rapid gene expression kinetics as compared to the Tet-off system. One drawback of the Tet...
-
Antibodies 101: Affinity Tags
TypeBlog Post... (FLAG, Myc, etc.) and fluorescent protein tags (GFP, mCherry, etc.). Fluorescent tags are primarily used...work best attached to, and the species they are compatible with are all reviewed here. What are affinity... -
Sleeping Beauty Awakens for Genome Engineering
TypeBlog Post..., hygromycin) and fluorescent protein reporters (GFP, BFP, RFP, no FP). The vectors each contain two SfiI...efficiencies of stable gene transfer using SB100x were comparable to stable transduction efficiencies of integrating... -
Why Add Sucrose? Improved Yields for Adeno-associated Virus Preparation
TypeBlog Post...endocytosis of a fluorescent dye and transduction of GFP-expressing AAV particles we did not observe any difference...demonstrate that these results were, in fact, due to impaired endocytosis. In parallel assays designed to test... -
Viral Vectors 101: Parts of the AAV Transfer Plasmid
TypeBlog Post...or smaller. Some examples include a reporter like GFP, some smaller CRISPR-Cas proteins such as SaCas9,...secondary structure and high GC content, but some companies now offer Sanger sequencing conditions which can... -
A New Optogenetic Tool Based on AraC Controls Gene Expression with Blue Light
TypeBlog Post...strain transformed with pBLADE expressing superfolder GFP instead of mCherry under the PBAD promoter. They ...What advantages does BLADE have over AraC? When compared to the original AraC system, BLADE is simply more... -
Donations from Addgene to Yield Answers for Rare Disease Researchers
TypeBlog Post... University with David Goldstein’s lab, will use GFP-ATP1A3, FLAG-ATP1A3, and ATP1B3 plasmids to explore...paralysis (hemiplegia) that are often painful and accompanied by migraines. Those attacks can be brought on... -
Another Pathway into Cells: iTOP
TypeBlog Post...Neuronal stem cells transduced with iTOP resulting in GFP expression. Image courtesy of Diego D'Astolfo. ...percentages (78-79% after two rounds of transduction.) Compared to CCP transduction, iTOP is at least four times...Astolfo et al. were eager to see if iTOP would be compatible with CRISPR/Cas9 genome editing. Although CRISPR... -
Validated gRNA Sequences
TypeCollection...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria... -
CRISPR 101: Multiplex Expression of gRNAs
TypeBlog Post...destination vector contains GFP, enabling you to select cells with high GFP expression. These cells have...Oligonucleotides specifying the gRNA seed sequence should be compatible with type IIS enzyme BfuAI. Gateway cloning is...supply it with another plasmid. Figure 3: Comparison of Multiplex Strategies including Standard PolIII-gRNA...Cas9-containing binary vectors. The system is compatible with both monocot and dicot plants. Liu Lab Golden... -
New and Upcoming Viral Vectors - September 2019
TypeBlog Post...collection is now complete! pAAV-CAG-GFP (plasmid 37825) and pAAV-hSyn-EGFP (plasmid 50465) are now available...our entire AAV inventory. Our new AAVs include: EGFP-expressing AAV for serotype testing Calcium sensors... testing AAV, which are small (20 ul) samples of EGFP-expressing AAV packaged in various serotypes. This...recently released these controls: pAAV-hSyn-DIO-EGFP (50457-AAV5): The Synapsin promoter directs broad...broad, neuronal expression. AAV pCAG-FLEX-EGFP-WPRE (51502-AAV5): The CAG promoter directs ubiquitous expression...interneurons. pOTTC1032 - pAAV EF1a Nuc-flox(mCherry)-EGFP (112677-AAV5 and 112677-AAVrg): The EF1a promoter...mCherry in the absence of Cre, and expresses nuclear EGFP in the presence of Cre. Biosensor AAV (calcium ... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...comprehensive comparison to GFP, please refer to NEB's comparison of SNAP-tag, CLIP-tag, and GFP . Technology...internal or surface proteins Single constructs are compatible with multiple applications (different fluorophores... -
Serotype Testing AAV
TypeCollection...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information... available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing...encode fluorescent reporters and can be used to compare the tropism of different serotypes. In addition... 37825-AAVrg.T 20 µL $ 140 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For... -
Multiplexed Overexpression of Regulatory Factors (MORF) collection
TypeBlog Post...library comes either with or without mCherry and GFP fluorescent controls. Alternatively, you can order... TF library (aka the MORF Collection) and an accompanying expression atlas, including over 3,500 human...endoderm, and mesoderm). These profiles were then compared to that of reference cell types generated by the... -
Plasmids 101: Mammalian Vectors
TypeBlog Post...be another method to assess transfection success. GFP is often used as a reporter and we will be covering...cells. Of course, these mammalian vectors must be compatible with the cell type they are tranfected into –...called transfection. Transfection is somewhat comparable to bacterial transformation (the introduction... -
Fluorescent Protein Travel Awards - Protein Variants, a Serotonin Sensor, and an Artificial Leaf Replica System
TypeBlog Post...fluorescent protein topics page Get the basics on GFP Find microbiology blog posts Resources on Addgene.org...variant library is monitored by fusing the variants to eGFP followed by an internal ribosomal entry site and...a variant has wild-type levels of abundance, the eGFP will be stable and fluoresce. But if the variant...unstable, it will be degraded, leading to reduced eGFP fluorescence. Cells expressing the library are then...fluorescence-activated cell sorting into four bins based on their eGFP:mCherry ratios. Genomic DNA from each bin are then extracted...and colonization opportunities for bacteria. To compare the artificial leaf to A. thaliana leaf, Bernach... -
Scientists Map the SARS-CoV-2-Human Interaction Network
TypeBlog Post...the viral protease, Nsp5. Our set also includes a GFP construct as a control. For easier portability, all...the human interactors we found in our map have an impact on virus replication. While we and our collaborators... -
Synthetic Photobiology: Optogenetics for E. coli
TypeBlog Post...via phosphorylation, promoting transcription of a GFP reporter. Subsequent exposure to red light rapidly...expression levels are optimal. These tools are compatible with many strains of E. coli, as well as with... -
Fluorescent Protein Guide: Biosensors
TypeCollection...Calcium erGAP3 (GFP-Aequorin Protein) for imaging of Ca+ dynamics in endoplasmic reticulum GFP-Aequorin Protein...FlincG3 (GFP-based cGMP sensor) for imaging in C. elegans neurons Using a Robust and Sensitive GFP-Based ...2020 GENIE Project Calcium jGCaMP7 High-performance GFP-based calcium indicators (Constitutive or Cre-dependent...cyclic AMP) Signaling reporter island (SiRI) with GFP-based fluorescent reporter cAMPr Spatial Multiplexing... FLAMP Plasmids Jun Chu cGMP (cyclic GMP) FlincG GFP-based cGMP sensor Differential patterning of cGMP... vascular smooth muscle cells revealed by single GFP-linked biosensors. Proc Natl Acad Sci U S A. 2008...autophagic flux by pH-sensitive fluorescence (pMRX-IP-GFP-LC3-RFP) An Autophagic Flux Probe that Releases an... -
Bacterial Expression Systems
TypeCollection...Vladislav Verkhusha 52732 52733 pET11a-link-NGFP pMRBAD-link-CGFP GFP (reconstructed) BiFC Lynne Regan 168257...Fluorescence (GFP+) Gram-negative bacteria Philip Poole 14460 pOT2 Promoter activity Fluorescence (GFPuv) Gram-negative... Guide to Selecting Fluorescent Dyes and Ligands GFP Fusion Proteins — Making the Right Connection Photoactivatable...pRsetB-his7-Perceval ATP:ADP ratio Fluorescence (GFP) Escherichia coli Gary Yellen 187836 pVoPo-01 Promoter...bacteria Philip Poole 14083 pAKgfplux1 Promoter activity Fluorescence (GFPmut3a) and luminescence (lux operon...bacteria Attila Karsi 14076 pAKgfp1 Promoter activity Fluorescence (GFPmut3a) Gram-negative bacteria Attila...-M ATP Fluorescence (GFPmut2) Escherichia coli Rahul Sarpeshkar 111614 pCdrA-gfpC Cyclic di-GMP Fluorescence...