We narrowed to 958 results for: tes
-
TypeBlog Post...sure your manuscript fits the house style and prerequisites of the journal. Ask colleagues (preferably native...
-
Form Your Own Peer Mentoring Group: A How-To Guide for Scientists
TypeBlog Post...each other practice meeting people – compete for fastest to set up a coffee date or most cards collected... -
Will You Be My Mentor? Finding and Asking for Mentoring Support
TypeBlog Post...Success”. Choose 1-2 tactics to try. One of my favorites is making the pledge to have lunch or coffee with... -
Sequencing Primers
TypeGuide...primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC... -
Antibodies 101: Fab Fragments
TypeBlog Post...scenario. References and resources References Bates A, Power CA (2019) David vs. Goliath: The Structure... -
Transferable Skills Guide: Problem Solving
TypeBlog Post...come up with several hypotheses on the cause. To test the most likely cause, you implement an experiment... -
Hot Plasmids April 2018 - Protein Degradation, Nanoscopy, FIRE-Cas9, and Yeast Expression Tools
TypeBlog Post...aberrantly activate the proteasome. Clift et al. tested multiple methods for TRIM-Away delivery. For small... -
Developing Lab Management Software for Biology
TypeBlog Post...academic labs where postdocs, students, and lab mates are coming and going frequently - an environment... -
Career Coaching for Scientists: Why and Where Do I Find One?
TypeBlog Post... email me with suggestions. Most coaches have websites you can review and most create useful online content... -
Open Resources and Plasmid Tools For Studying C. elegans
TypeBlog Post...Caenorhabditis Genetics Center (CGC) which maintains and distributes the strains all over the world. When I was at... -
Engaging with science and society at pgEd
TypeBlog Post... lot of researching and writing – following the latest developments in genetics research, their applications... -
Overcoming the Challenges of Lentiviral Production
TypeBlog Post...third generation packaging systems, this system incorporates the Tet-off transcriptional activation system... -
Hot Plasmids May 2018 - Optogenetics, Decaffeination, Biosensors, and Fluorescent Protein Tools
TypeBlog Post...conversion into xanthine. The majority of this operon originates from Pseudomonas putida CBB5 and has been tailored... -
Adeno Associated Virus (AAV) for Cell and Gene Therapy
TypeBlog Post... Hirsch, M. L., et al. "Self-complementary AAV mediates gene targeting and enhances endonuclease delivery... -
Viral Vectors 101: Calcium Sensors
TypeBlog Post...engineered with a reduced number of calcium binding sites per sensor (to decrease unnecessary calcium buffering... -
Viral Vectors 101: Chemogenetics
TypeBlog Post...activation is delayed and takes on the order of minutes. Studies looking at immediate effects of specific... -
Hot Plasmids and Viral Preps - January 2021
TypeBlog Post...well-characterized Cas enzymes, which rely on multiple active sites. In addition, Casɸ has a minimal PAM requirement... -
CRISPR 101: Anti-CRISPR Proteins Switch Off CRISPR-Cas Systems
TypeBlog Post..., 2018). For example, AcrIIA4 mentioned above indicates that it’s the fourth Acr protein discovered that... -
Meet an Addgenie: Insights into Grad School, Career Paths, and More
TypeBlog Post...Associate Scientist at Bristol Myers Squibb and also writes for the Addgene blog. A few of my friends in the... -
Science communication: 9 Strategies to Get Your Foot in the Door
TypeBlog Post...-scientists in an unusual setting: Discuss your latest research in a local pub at a Pint of Science event...