Skip to main content
Addgene
Showing: 781 - 800 of 934 results

  1. Sequencing Primers

    Type
    Guide
    ...primer pAd-CMV GCTAGAGATCTGGTACCGTC For cloning sites after SalI in pAd-CMV vector pBABE 3' ACCCTAACTGACACACATTCC...

  2. Protocol - How to Ligate Plasmid DNA

    Type
    Protocol
    ... 0.5-1μL T4 DNA Ligase H 2 O to a total of 10μL Notes: If the DNA concentrations are low such that you...troubleshooting failed ligations. The following table indicates the various controls: Control Ligase Interpretation...

  3. Immunocytochemistry

    Type
    Protocol
    ...of our protocols supports reproducibility and accelerates science. Here, we list the specific equipment... Equipment Pipette controller Pipette tips and pipettes Rocking platform Tweezers Fluorescent microscope...

  4. Colony Formation Titering Assay

    Type
    Protocol
    ...lots of FBS can promote or inhibit transfection. Test a variety of brands and lots of FBS to find one ...solution through a 0.22 μm filter to remove any precipitates. Stain each well with 1 mL of 0.1% crystal violet...

  5. New Antibody Animation!

    Type
    Blog Post
    ...Ready to learn about antibodies? Our latest animation is here to help! Join Abi as they explain what ...

  6. New Coomassie Protocol Video

    Type
    Blog Post
    ...determine your antibody's purity? Check out our latest protocol video, "Coomassie Purity Stain of Recombinant...

  7. Antibodies 101 Series on TikTok

    Type
    Blog Post
    ...regularly from now until May, so follow us to get updates whenever a new video is posted! If TikTok isn't...

  11. The 12 Days of CRISPR: 2021

    Type
    Blog Post
    ...CRISPR? Neither can we! Subscribe below to get updates on all our CRISPR content.  ...

  13. We’re Going Viral This Week!

    Type
    Blog Post
    ...publishing research. Addgene’s research team also investigates new strategies to improve viral vector production...

  15. The Twelve Days of CRISPR

    Type
    Blog Post
    ...On the sixth day of CRISPR, Addgene gave to me: updates on base editing from the first generation of base...

  16. New Videos: Addgene Lab Tips

    Type
    Blog Post
    ...Tip” filter on the blog to keep up to date on the latest episode.  Have some suggestions for future tips...
Showing: 781 - 800 of 934 results