We narrowed to 160 results for: mPA-GFP
-
TypeCollection... PINK1 N-GFP PINK1 GFP CMV Parkinson's Mark Cookson 13316 pcDNA-DEST47 PINK1 C-GFP PINK1 GFP CMV Parkinson's...21190 GFP-pcDNA3-PKCgamma-cys1Acys1B PRKCG GFP CMV Spinocerebellar ataxia 27 Tobias Meyer 21204 GFP-N2-PKCgamma...PKCgamma PRKCG GFP CMV Spinocerebellar ataxia 26 Tobias Meyer 21205 GFP-C1-PKCgamma-C1A PRKCG GFP CMV Spinocerebellar...Parkinson's, FTD Michael Davidson 57146 mPA-GFP-MAPTau-N-10 MAPT GFP CMV Parkinson's, FTD Michael Davidson...-HtrA2-EGFP HTRA2 GFP CMV Parkinson's L. Miguel Martins 14122 pcDNA3-HtrA2-EGFP S306A HTRA2 GFP CMV Parkinson's... GPD 25QDProGFP p416 HTT GFP GPD Huntington's Susan Lindquist 15569 GPD 104QDProGFP p416 HTT GFP GPD Huntington's...GAL 25Q+ProGFPp416 HTT GFP GAL1 Huntington's Susan Lindquist 15581 GAL 46Q+ProGFPp416 HTT GFP GAL1 Huntington's...
-
Antibodies 101: Designing Your First Flow Panel
TypeBlog Post...extent they overlap. Figure 4 compares the spectra of enhanced GFP (eGFP) and FITC, the latter being a...to fuse them with a fluorescent reporter, such as GFP or mCherry, through genetic modification. As your... you can also use fluorescent reporters, such as GFP, and fluorophore-conjugated antibodies together in...vector also encodes for eGFP, which serves as a transduction reporter. Note that eGFP is not fused to CD45...-Cy7. Next comes our transduction reporter, eGFP. As eGFP emits fluorescence by itself and does not need...cytometer which channel to use to detect eGFP. As you saw in Figure 4, eGFP strongly overlaps with FITC, hence...results in a higher-wavelength emission spectrum compared to APC. This happens due to a process called Fluorescence... -
Interview: Nicola Patron on Plant Synthetic Biology, MoClo, and More
TypeBlog Post... FRET tools, double dimerization GFPs, and circular permutation GFPs. Hopefully we will have new tools...few new ones that are not used so much but have comparable expression levels to things people do use a lot...committees, and how the culture of the university impacts the number of women reaching senior positions. ... those amazing students that want to have a big impact on the world and tell them to work in plant science... -
Negative Can Be Positive: Open AAV Data with Addgene
TypeBlog Post... cassette with an ubiquitous promoter to express GFP in a group of young rats. We found that, in this ...label norepinephrine (NE) expressing neurons and GFP (green) to label neurons transduced by each serotype...much the spread of the virus to adjacent areas impacted the experiments we wanted to perform. It required...literature, scientists can use the Data Hub to compare different methods and vectors, and use this data... rat CNS: AAV PHP.EB vector dose–response and comparison to AAV PHP.B. Gene Therapy, 25(5), 392–400. https..., C., & Flotte, T. R. (2015). Stability and compatibility of recombinant adeno-associated virus under ... -
Hot Plasmids - August 2020
TypeBlog Post...GABA-ergic interneurons. These include mDlx-GFP, hDlx-FLEX-GFP, hDlx-Flex-dTomato, mDlx-GCaMP6f, hDlx-GiDREADD-dTomato...fluorescent tools for labeling structures and compartments in mammalian cells By Angela Abitua Genetically...are often used to label specific structures, compartments, or specific localization of biomolecules within...usually much easier to clone, express, and purify compared to antibodies. Nanobodies are easily expressed...pMAK463 (NBαMouse-IgK, Addgene #140701) pMAK464 (NBαEGFP, Addgene #140702) The pMAK461-64 plasmids were...introduced into the hPSC genome using AAV1 and contain an EGFP reporter. Expression of the dCas9-KRAB activator... -
Which Fluorescence Microscopy Technique is Best for Me?
TypeBlog Post...two photons of red light are needed to excite GFP compared to only one of blue. Only at the focal point...red light instead of blue to excite a molecule of GFP. Because red light has approximately half the energy...infinitely small point of light – think of a single GFP molecule – will appear as a fuzzy 200-300 nm spot... -
Light Sheet Fluorescence Microscopy
TypeBlog Post...mouse brains expressing green fluorescent protein (GFP) (6). The Dodt and Frank Bradke laboratories later...subpopulation of neurons are brightly labeled with GFP (e.g. Thy1-YFP-H mice). However, we recently developed... nerve afferents labelled with a AAV8 expressing eGFP under the human ubiquitin C promoter. Anatomical...labeling in whole tissue (15). CLARITY is also compatible with LSFM, a method termed COLM (clarity-optimized...spatiotemporal control over labeling methods as compared to transgenic animals (17). These viral plasmids... -
Plasmids 101: Protein tags
TypeBlog Post...protease protection. Thus far Plasmids 101 has covered GFP and its related fluorescent proteins, which are sometimes... I Use? Plasmids 101: Green Fluorescent Protein (GFP) Fluorescent Protein Guide Expression Vectors from...into a translated protein. As depicted in the accompanying cartoon, they have a multitude of uses including...ProtA IgG-binding domains. TAP has since come to encompass several other tag combinations, though frequently... -
Save Time with Transient Plant Leaf Transformations
TypeBlog Post... N. C. A., et al. "Evaluation and comparison of the GUS, LUC and GFP reporter system for gene expression...tMAS::rLUC-I::pMAS. Fluorescent proteins (FP, e.g. GFP) can be used in many ways. Often a FP is fused to... -
Hot Plasmids Spring 2024
TypeBlog Post...Figure 5: A) Representative confocal images showing GFP expression from ssAAV5s with hIBA1 or hIBA1a promoters...Quantifications showing high microglia specificity of GFP expression for the indicated ssAAV5s. C) Quantifications...-multi (Walton et al. 2024). This platform is compatible with enrichment, single-cell sequencing, and ...CRISPRi screen to identify additional host factors impacting prime editing and found the protein La (a small...scAAV). However, scAAV vectors have limited size compared to single-strand AAV (ssAAV). To maintain the ... -
New Acoustic Reporter Genes: Ultrasound Imaging of Gene Expression
TypeBlog Post...P2A-linked accessory genes gvpNJKFGWV marked with Emerald GFP. These plasmids can be used directly in transient...gating for the top quartile (or higher) of BFP and GFP producing cells. After FACS, return the cells to ...structural protein GvpA, which seemed overexpressed compared to accessory proteins. Excess gvpA plasmid added... -
Rinehart Lab Phosphoprotein Reagents
TypeCollection...68299 GFP E17TAG/Q157TAG Plasmid 68298 GFP S2TAG/E17TAG Plasmid 68297 GFP Q157TAG Plasmid 68296 GFP S2TAG...Library 111704 Mode #1 Library Plasmid 69118 E17TAG GFP zeo resistance Plasmid 68307 SupD Strain 68306 C321...S2TAG Plasmid 68295 GFP E17TAG Plasmid 68294 SepOTSν Plasmid 68292 SepOTSλ Plasmid 68291 SepOTSκ Plasmid...pSerOTS-C1* (V70) is a ROP minus plasmid and is not compatible with other plasmids containing high copy ColE1... -
Viral Production
TypeCollection... later, Cre-dependent GFP expression was detected with direct fluorescence. GFP was not detected in the...viral genomes (vg)/cell, pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] (Addgene 84445-AAVrg) alone at 1.1E6 vg/mL, ... prep # 55632-AAVrg). pAAV-CAG-FLEX-rc [Jaws-KGC-GFP-ER2] was a gift from Edward Boyden (Addgene viral...Purity Purity of AAV preparations is assayed by comparing the relative stoichiometric ratios of the viral... -
Validated gRNA Sequences
TypeCollection...25849248 Du GFP A. victoria GAATAGCTCAGAGGCCGAGG 46914 interfere S. pyogenes 23849981 Qi GFP A. victoria...inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A. victoria...GGAGCGCACCATCTTCTTCA 41820 cut S. pyogenes 23287722 Church GFP A. victoria GTGAACCGCATCGAGCTGAA 41819 cut S. pyogenes...GGCGTCTCGATTGTGAGAGC 54467 cut S. pyogenes 24825012 Sibley GFP Synthetic gRNA1: GAGCTGGACGGCGACGTAAA; gRNA2: CAGAACACCCCCATCGGCGA...Christiaen EGFP A. victoria multiple, see article 60071 dCas9-FokI S. pyogenes 24770325 Joung EGFP A. victoria...24336571 Zhang EGFP A. victoria GAGCTGGACGGCGACGTAAA 51761 cut S. pyogenes 24336571 Zhang EGFP A. victoria... -
Fluorescent Proteins 101: Fluorescent Biosensors
TypeBlog Post...biosensors as an example. Many calcium biosensors include GFP fused to calmodulin (CaM) and the chicken myosin ...biosensors can be targeted to a particular cellular compartment such as the nucleus, mitochondria, endoplasmic... biosensor: which fluorescent protein is most compatible with your lab and experimental setup? Consider... -
Antibodies 101: Introduction to Antibodies
TypeBlog Post...blot showing GFP expression in cells that have been transfected with a plasmid encoding GFP. Actin, a common...production strategy has advantages and disadvantages compared to each other. Polyclonal antibodies These antibodies...stability. Additionally, the choice of vector can impact the expression level of an antibody (Ayyar et al...Single-chain variable fragment (ScFv) Figure 2: Comparison between the IgG antibody and scFv. Because... their lower affinity for their target protein compared to whole antibodies (Crivianu-Gaita 2016). Get...Variables (scFvs). Nanobodies Figure 3: Comparison of the Hcab and nanobody. Nanobodies are the...fluorescence. Western blots are frequently used to compare relative levels of protein expression between cell... -
New England Biolabs Cell-Imaging Plasmid Collection
TypeCollection...comprehensive comparison to GFP, please refer to NEB's comparison of SNAP-tag, CLIP-tag, and GFP . Technology...internal or surface proteins Single constructs are compatible with multiple applications (different fluorophores... -
Serotype Testing AAV
TypeCollection...AAV1). AAV Vectors for Serotype Testing pAAV-CAG-GFP (Plasmid #37825) Description : Ready-to-use AAV in...plasmid 37825 (deposited by Edward Boyden ) and direct GFP expression from the CAG promoter. For information... available from Addgene's viral service. Control EGFP vectors in various serotypes for serotype testing...encode fluorescent reporters and can be used to compare the tropism of different serotypes. In addition... 37825-AAVrg.T 20 µL $ 150 Add to Cart pAAV-hSyn-EGFP (Plasmid #50465) Description : Ready-to-use AAV ...plasmid 50465 (deposited by Bryan Roth ) and direct EGFP expression from the human synpasin promoter. For... -
New Norepinephrine Indicators: nLightG and nLightR
TypeBlog Post...fluorescent protein (GFP), and nLightR uses a red fluorescent protein, mApple. Kagiampaki et al. found nLight...norepinephrine indicators: nLightG and nLightR (Kagiampaki et al., 2023). Figure 1: Properties...μm (neurons). Figure and caption adapted from Kagiampaki et al., 2023. nLight nLight sensors are based... https://doi.org/10.1016/j.neuron.2019.02.037 Kagiampaki, Z., Rohner, V., Kiss, C., Curreli, S., Dieter... -
Year of the Camelid: Antibody Style
TypeBlog Post...highlighted back in 2015, where sdAbs were used to create GFP scaffolds for transcriptional activation. sdAbs ...to revisit some of the ways these animals have impacted humans through biomedical research. The Camelid...Arbabi-Ghahroudi, 2017)! Figure 1: Comparison of a heavy-chain only antibody and single-domain...blog over the years and have described how they compare to other antibodies and affinity reagents. But ...And I suspect we will only continue to see their impact grow as new sdAbs become easier to generate and...