Skip to main content
Addgene
Showing: 61 - 80 of 1033 results
  1. Deisseroth INTRSECT Collection

    Type
    Collection
    ...Mazzone CM, D'Agostino G, Halladay LR, Hardaway JA, DiBerto JF, Navarro M, Burnham N, Cristiano C, Dorrier...following resources may be of interest for groups interesting in implementing intersectional experimental design... in a new window) for the molecular design and testing of novel INTSRECT plasmids for groups interested...Wang W, Robertson K, Osten P, Sabatini BL. 2019. Distinct Cortical-Thalamic-Striatal Circuits through the...
  2. Jaenisch Lab CRISPR Plasmids

    Type
    Collection
    ...Table 4. Gateway Destination Vector ID Plasmid 48222 pAC90-pmax-DEST : Gateway Destination vector derived...48218~48221] and can be transferred to Gateway destination vectors (e.g., pmax-DEST [48222] and (Link opens...opens in a new window) Lifetechnologies Gateway Destination Vectors ) to adapt to different systems by LR...
  3. Malate Dehydrogenase CUREs Community Collection

    Type
    Collection
    ...teaching different types of courses, at any type of institution, and at different points in their careers to ...inexpensive to assay, and easy to purify using histidine-tagged constructs and routine protein and molecular...facilitates scientific collaborations between institutions. With these plasmids, faculty can begin a sustainable...watermelon, Streptomyces ) Subcellular compartment (chloroplastic, cytoplasmic, glyoxysomal, mitochondrial, peroxisomal...
  4. mTOR Pathway

    Type
    Collection
    ...Pathway Plasmids mTOR Gene List Resources The m echanistic or m ammalian t arget o f r apamycin (mTOR) is...known as STK11; serine/threonine kinase 11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40...Mitogen-activated protein kinase associated protein 1 mTOR Mechanistic target of rapamycin p53 TP53; tumor protein p53...nrd4505. PubMed PMID: 25743081 . Do you have suggestions for other plasmids that should be added to this...
  5. Microbiology Resources

    Type
    Collection
    ...plasmids Addgene distributes cannot be used to reconstitute self-replicating microbes or recreate the diseases...Synechococcus sp. Thermus sp. Vibrio sp. Yersinia pestis Plasmids for Cyanobacteria Cyanobacteria Plasmids...community by depositing your useful tools , or by suggesting plasmids for the collection. Return to top Plasmid...opens in a new window) Return to top Do you have suggestions for other plasmids that should be added to this...
  6. Adenovirus Guide

    Type
    Guide
    ...Components Vector Construction Frequently Asked Questions (FAQ) Glossary Adenoviral Components The adenovirus...Packaging Methods Return to Top Frequently Asked Questions (FAQ) about Adenoviral Vectors Are adenovirus ...
  7. Neurodegeneration Research Collection

    Type
    Collection
    ...years from symptom onset. Disease mechanisms are still poorly understood but several genes and mapped loci...other large scale studies. Researchers are now investigating the role that these additional genes may play...Noteworthy: Study aberrant axon initial segment (AIS) plasticity with a motor neuron-specific reporter and a PAX7...accelerate discovery and advance development of diagnostics and treatments for Alzheimer’s disease and related...
  8. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...sgRNA(F+E) 59986 Other/Ciona intestinalis BsaI none S. pyogenes Christiaen p(U6a-BsaI-gRNA) 65955 Other...Golden Gate cloning or the Gibson Assembly. Chen Boosting CRISPR/Cas9 multiplex editing capability with ...into Tol2-based pGGDestTol2LC vector. Uses five distinct zebrafish U6 promoters for sgRNA expression. Chen...genes in Escherichia coli. Koffas Do you have suggestions for other plasmids that should be added to this...
  9. Fluorescent Protein Guide: Activity Regulation

    Type
    Collection
    ... using modular components or take advantage of existing GFP-lines for cell-specific manipulation. Plasmids...Plasmids Fluorescent Protein Purpose Principal Investigator Plasmids GFP GFP-dependent transcription factors...activity Michael Lin See Plasmids Do you have suggestions for other plasmids that should be added to this...
  10. Luciferase Plasmids

    Type
    Collection
    ...Luciferase-containing plasmids are commonly used to investigate the effect of regulatory elements, such as promoters...constructs available that are driven by a strong constitutive promoter and can be used to monitor transfection...Expression Constructs Luciferase driven by a strong constitutive promoter and can be used to monitor transfection...Description Gene/Insert PI Return to Top Do you have suggestions for other plasmids that should be added to this...
  11. AAV Viral Preps

    Type
    Collection
    ...includes titering, purity assessment, sterility testing, and viral genome sequencing (VGS). In-stock AAV...Neuronal Tracing Rabies Virus-Based Serotype Serotype Testing Samples Small samples of control AAV vectors for...CAP-B10, CAP-B22 University of Florida Serotype Testing Panel for the Eye and Brain For enhanced transduction...
  12. Cre-lox system

    Type
    Collection
    ...Eisenhoffer 131783 pTol2-CreLite CreLite; Tol2 destination vector with mTagBFP2 Zebrafish Eisenhoffer 131785...constructs Cre-loxP recombination is used to create a stochastic choice of expression among fluorescent proteins...indelible marking of mouse neurons with multiple distinct colors Mammalian Sanes See article Multibow constructs...which reporters are initially OFF and then probabilistically ON or OFF following Cre recombination to maximize....0403954101. Epub 2004 Jul 6. PubMed . Do you have suggestions for other plasmids that should be added to this...
  13. EXtracellular Plasmid RESource (EXPRESs) Consortium

    Type
    Collection
    ...egg Laboratories using AVEXIS: Christian Sollner, Max Planck Institute Mitch Levesque University of Zürich...Zürich Gavin Wright , Wellcome Sanger Institute Protocols: Video showing how AVEXIS works with a detailed...
  14. Synthetic Biology - Overview

    Type
    Collection
    ...Phosphoprotein Kit S. cerevisiae Advanced Gateway Destination Vectors TAL Effectors Zinc Finger Consortium ...ethical synthetic biology JBEI - Joint Bio-Energy Institute Synberc - Synthetic Biology Engineering Research...Synthetic Biology - Open access journal Do you have suggestions for other plasmids that should be added to this...
  15. Trimmer Lab NeuroMab Collection

    Type
    Collection
    ...NPY2R Human Mouse IgG2a 177465 Anti-Collybistin [L120/30R] Collybistin Rat Mouse IgG2a 177466 Anti-nNOS/...Alpha1 Human Mouse IgG2a 177575 Anti-Collybistin [L120/12R] Collybistin Rat Mouse IgG2a 182096 Anti-Kv2.1...IgG2a 225365 Collybistin (Rattus norvegicus) recombinant monoclonal antibody. Collybistin Rat Mouse IgG2a...BAIAP2 Human Mouse 190507 Collybistin scFv [L120/12] L120/12 scFv Collybistin Rat Mouse 190508 Bassoon ...R-mAbs have been engineered such that they are a distinct IgG subclass from the conventional mAb to facilitate...
  16. Worm Expression Resources

    Type
    Collection
    ...community by depositing your useful tools , or by suggesting plasmids for the collection. Return to top Plasmid...on miniMos and MosSCI plasmids can be found on Christian Frøkjær-Jensen's Wormbuilder website. General ...organism C. elegans. Return to top Do you have suggestions for other plasmids that should be added to this...
  17. Genetic Code Expansion

    Type
    Collection
    ...non-canonical amino acid can be incorporated using the existing protein translation machinery. To expand the genetic...a protein so that it is responsive to specific stimuli, such as light. On a broader scale, the expanded...127411 pEVOL-pylT-N346A/C348A PylRS M. mazei mono-substituted phenylalanine derivatives and tyrosinyl ethers...pMAH-POLY-eRF1(E55D) POLY-eRF1(E55D) E. coli para-substituted phenylalanine analogs Mammalian TAG Huiwang Ai...
  18. Validated gRNA Sequences

    Type
    Collection
    ...Joung Ebf C. intestinalis GCTGAGGGTTGGACAACAGG 59990 cut S. pyogenes 25336740 Christiaen EGFP A. victoria...negative control C. intestinalis GCTTTGCTACGATCTACATT 60006 cut S. pyogenes 25336740 Christiaen negative control...
  19. Rinehart Lab Phosphoprotein Reagents

    Type
    Collection
    ...changed the way researchers can explore important questions surrounding serine phosphorylation by adding this...improved phosphoprotein yield, rEcoli growth characteristics, and an overall improved ease of use when expressing...precise knowledge of phosphorylated positions for testing phosphoproteomics methods, proteomics search algorithms...
  20. CRISPR Plasmids - Tagging

    Type
    Collection
    ...Genetics 2014 Allen Institute for Cell Science Plasmid Collection The Allen Institute for Cell Science has...and EGFP are available at Addgene. Do you have suggestions for other plasmids that should be added to this...
Showing: 61 - 80 of 1033 results