...fluorophores to distinguish between cells. Most flow experiments will use one marker to distinguish between live... Minibodies are engineered antibody fragments consisting of two scFvs bound to a CH3 domain. Fab fragments...measurable light or color in response to a specific stimulus, can be conjugated to antibodies in order to allow...machine or by X-ray film. HRP cannot be used to distinguish between different antibodies in the same reaction...the number of signaling molecules that can be distinguished in your application. The indirect detection ...molecule to epitope ratio. Secondary antibodies can distinguish between different species of origin, isotypes...between DNA and protein. Micrococcal nuclease digestion is used to shear the DNA in these assays. This...

...the other half to CIB1, light-stimulated heterodimerization can reconstitute the protein. This principle...examples of relevant variants. This list is not exhaustive - please browse our curated list of opsins here...neurons upon exposure to light through direct stimulation of ion channels. Naturally occurring channelrhodopsins... nonspecific cation influx into the cell when stimulated. Channelrhodopsin-2 (ChR2), the first widely ...domains from two different ChRs. These ChR variants still function as light-gated, cation channels resulting...Chronos High-speed, light-sensitive channel from Stigeoclonium helveticum 500 Chrimson, ChrimsonR Red-light...population, or activate different neural populations at distinct times. Temporal considerations. Temporal precision...

...oligonucleotide stitching, in which pieces of DNA that share no end homology can still be fused together...Gibson Type IIS Ligation Independent Cloning Oligo Stitching Molecular cloning or the creation of recombinant...containing precise 5' or 3' single-strand overhangs (sticky ends), or no overhang (blunt ends). Two pieces ...is done via a single recombination reaction, drastically simplifying the process and reducing the amount...rapidly shuttled into any compatible Gateway® Destination vector, which contain attR sites via LR clonase...clonase enzymes. Thousands of Gateway® destination plasmids have been made with different promoters, tags...are two-fold. First, the entire cloning step (digestion and ligation) can be carried out in one reaction...

...PMID: 25398340 Walton, R. T., Christie, K. A., Whittaker, M. N., & Kleinstiver, B. P. (2020). Unconstrained...Publications CRISPR Overview Bacteria have an interesting adaptive immune response that detects and eliminates...DNA with no homology elsewhere in the genome. Realistically, most gRNA targeting sequences will have additional..., a large portion of the Cas9-induced DSBs will still be repaired via NHEJ. The resulting population of...integrase landing site ( attB ) and the other to stimulate DNA repair. This can result in more efficient ...activity. Knockout libraries often target 5′ constitutively expressed exons, while activation and repression...repression, many CRISPR epigenetic tools require constitutive expression of the dCas9 fusion and/or expression...

...Description CMV Constitutive Strong mammalian promoter from human cytomegalovirus EF1a Constituitve Strong mammalian... factor 1 alpha CAG Constitutive Strong hybrid mammalian promoter PGK Constitutive Mammalian promoter ...Description T7 Constitutive but requires T7 RNA polymerase Promoter from T7 bacteriophage Sp6 Constitutive but requires...Inducible Tetracycline response element promoter U6 Constitutive Human U6 nuclear promoter for small RNA expression... simpler than eukaryotic transcription bacteria still have complex systems of gene regulation, like operons...polymerase Promoter from Sp6 bacteriophage lac Constitutive in the absense of lac repressor (lacI or lacIq...

... Human M3 muscarinic Arrestin-2/-3 CNO* Increase Arrestin translocation Arrestin signalling Nakajima &...vivo and the receptors exhibited high levels of constitutive activity, making them less than ideal. DREADDs...insensitivity to endogenous ligands, have low constitutive activity, and their activating ligands have ...G-protein and activate neuronal firing through stimulating phospholipase C, which releases intracellular...This DREADD was shown to have a small amount of constitutive activity, and is not widely used. There is also... also a DREADD that couples to β-arrestin to activate noncanonical GPCR signaling independent of G proteins...Gleixner J, Klein ME, Lu D, Barter JW, Rossi MA, Augustine GJ, Yin HH, Hochgeschwender U (2016). Luminopsins...

...thousand basepairs from the entire human genome. Digesting the human genome with restriction enzymes would...amplified) by bacteria, which is an important characteristic of why plasmids are convenient and easy to ...survive antibiotic treatment. It is important to distinguish that the antibiotic resistance gene is under ... easy insertion of DNA by restriction enzymes digestion and ligation. In expression plasmids, the MCS ...can be used for cloning by restriction enzyme digestion. For more information about restriction enzymes...are now used for a variety of studies used to investigate promoters, small RNAs, or other genetic elements...gram-negative, rod shaped bacteria naturally found in the intestinal tract of animals. There are many different naturally...

...insert to recombine with the destination vector (in this case the destination vector would be the lentiviral.... Viral Production Schematic Frequently Asked Questions (FAQ) about Lentiviral Plasmids What is the difference...using PCR. The process of subcloning consists of digesting the insert of interest from its parent vector ...lentiviral transfer vector). The destination vector contains attB sequences with which the attP sequences ...office can provide more information on your institution's best practices with regard to lentiviral research...post‐transcriptional regulatory element; sequence that stimulates the expression of transgenes via increased nuclear...generation vectors use a hybrid 5' LTR with a constitutive promoter such as CMV or RSV. 3' LTR in cis Terminates...

...such cases, it may be necessary to customize an existing reagent to suit your needs. Genetic Manipulation...expression vector Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); ...genetic knockouts, gRNAs commonly target 5′ constitutively expressed exons, which reduces the chances ...target with no homology elsewhere in the genome. Realistically, a given gRNA target sequence will have partial...protocol associated with the specific plasmid in question (see CRISPR protocols from Addgene depositors ...desired edit, as a large percentage of DSBs are still repaired by NHEJ. How do you determine that your...

...retroviral packaging systems and commonly asked questions... Packaging Systems Frequently Asked Questions (FAQ) Glossary γ-Retroviral Packaging Systems The widespread...Packaging Methods Return to Top Frequently Asked Questions (FAQ) about γ-Retroviral Plasmids How do engineered...post‐transcriptional regulatory element; sequence that stimulates the expression of transgenes via increased nuclear...

... sequencing primer" and "3' sequencing primer". Still not sure what primer you need? Email us at [email protected] GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-...primer HAT GAGGAGCACGCTCATGCCCAC (BD Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA...

...Components Vector Construction Frequently Asked Questions (FAQ) Glossary Adenoviral Components The adenovirus...Packaging Methods Return to Top Frequently Asked Questions (FAQ) about Adenoviral Vectors Are adenovirus ...

...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...

...Rep and Cap are translated to produce multiple distinct proteins (Rep78, Rep68, Rep52, Rep40 - required...