...Serotype Name Depositor 27056 AAVrg pAAV-Ef1a-DIO EYFP Karl Deisseroth 11447 AAV5 pAAV-Ef1a-fDIO mCherry...

...syn-FLEX-axon-jYCaMP1s. Find these AAVs at Addgene Cre-dependent EYFP AAV in the new serotype PHP.V1 that exhibits efficient...

...ET/TC)-EYFP nEF ChR2(E123T/T159C) EYFP Flp dependent 8 Deisseroth 26968 pAAV-Ef1a-DIO ChETA-EYFP EF1a ChETA...E123T/H134R)-eYFP.WPRE.hGH CaMKII ChETA EYFP Constitutive 9 Deisseroth 135633 pAAV-S5E2-C1V1-eYFP E2 C1V1 ...Arch3.3-EYFP nEF Arch3.3 EYFP Cre dependent 8 Deisseroth 137150 pAAV-nEF-Coff/Fon-Arch3.3-p2a-EYFP nEF Arch3.3...Arch3.3 EYFP Flp dependent 8 Deisseroth 20949 pAAV-double floxed-eNpHR-EYFP-WPRE-pA EF1a eNpHR EYFP Cre dependent...pAAV-CaMKIIa-eNpHR 3.0-EYFP CaMKII eNpHR 3.0 EYFP Constitutive 1, 9 Deisseroth 26972 pAAV-hSyn-eNpHR 3.0-EYFP Syn eNpHR...eNpHR 3.0 EYFP Constitutive 5 Deisseroth 137151 pAAV-nEF-NpHR3.3-EYFP nEF NpHR 3.3 EYFP Constitutive 8 ...NpHR3.3-EYFP nEF NpHR 3.3 EYFP Cre dependent 8 Deisseroth 137154 pAAV-nEF-Coff/Fon-NpHR3.3-EYFP nEF NpHR...

...eNpHR 3.0-EYFP Karl Deisseroth AV-1-26967M 100049-AAV1 pAAV.hSynap.ChETA(E123T/H134R)-eYFP.WPRE.hGH Karl Deisseroth...pAAV-Ef1a-DIO ChETA-EYFP Karl Deisseroth AV-1-26969P 26969-AAV1 pAAV-CaMKIIa-hChR2(H134R)-EYFP Karl Deisseroth...pAAV-CaMKIIa-eNpHR 3.0-EYFP Karl Deisseroth AV-1-26973P 26973-AAV1 pAAV-hSyn-hChR2(H134R)-EYFP Karl Deisseroth...pAAV-Ef1a-DIO eNpHR 3.0-EYFP Karl Deisseroth AV-5-26968P 26968-AAV5 pAAV-Ef1a-DIO ChETA-EYFP Karl Deisseroth ...pAAV-CaMKIIa-hChR2(H134R)-EYFP Karl Deisseroth AV-5-26972P 26972-AAV5 pAAV-hSyn-eNpHR 3.0-EYFP Karl Deisseroth ...floxed-eNpHR-EYFP-WPRE-pA Karl Deisseroth AV-9-26966P 26966-AAV9 pAAV-Ef1a-DIO eNpHR 3.0-EYFP Karl Deisseroth...E123T/H134R)-eYFP.WPRE.hGH Karl Deisseroth AV-9-26968P 26968-AAV9 pAAV-Ef1a-DIO ChETA-EYFP Karl Deisseroth...

...-fDIO EYFP Flp 55640 pAAV-Ef1a-dDIO hChR2(H134R)-EYFP Dre 55639 pAAV-Ef1a-fDIO hChR2(H134R)-EYFP Flp 126080...proof-of-concept targeting approach in 2014 1 (using EYFP and ChR2-EYFP as payloads). This approach has been broadly...mouse and rat lines. Plasmids In addition to EYFP and ChR2-EYFP, a large number of additional, validated ...pAAV-Ef1a-sCreDIO hChR2(H134R)-eYFP Scre 126081 pAAV-Ef1a-vCreDIO hChR2(H134R)-eYFP Vcre Dual recombinase-dependent...Mutations 55650 pAAV-hSyn Con/Fon EYFP Cre AND Flp 55651 pAAV-hSyn Con/Foff EYFP Cre AND NOT Flp F3/F5 137162...pAAV-Ef1a-Con/Foff 2.0-EYFP Cre AND NOT Flp FRT/F5 55652 pAAV-hSyn Coff/Fon EYFP Flp AND NOT Cre 137129... Con/Fon hChR2(H134R)-EYFP Cre AND Flp 55644 pAAV-nEF Con/Fon hChR2(H134R)-EYFP Cre AND Flp 55647 pAAV-nEF...

...-CAG-DIO-EYFP An AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the...AAV2 pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...AAV5 pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...AAVrg pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...PHPeB pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...Boyden 117382-AAV2 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter...Gradinaru 117382-AAV5 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter...

...minBG-SYFP2-WPRE3-BGHpA DLX2.0 (3xCore version of DLX enhancer). AAV vector for strong & rapid SYFP2 expression...PHPeB CN1839-rAAV-hSyn1-SYFP2-10aa-H2B-WPRE3-BGHpA AAV vector for nuclear SYFP2 labeling in neurons. Useful...pAAV-AiE0743m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3038) Expression of SYFP2 (yellow fluorescent protein...AiP12408 - pAAV-AiE0600m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2408) Expression of SYFP2 (yellow fluorescent protein...pAAV-AiE0779m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3044) Optimized expression of SYFP2 (yellow fluorescent...pAAV-AiE0888m_C4-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3863) Enhancer AAV for expression of SYFP2 in midbrain dopamine...pAAV-AiE0441h_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3905) Enhancer AAV for expression of SYFP2 in all striatal...

...rAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA minBetaGlobin SYFP2 Control Ting 163509 CN1839-rAAV-hSyn1-SYFP2-10aa-H2B-WPRE3...Dlx mRuby2 Control Gradinaru 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP...EF1a mCherry Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control Gradinaru 135630 pAAV-S5E2-dTom-nlsdTom...-BGHpA hSyn1 H2B-SYFP2 Control Ting 191706 AiP13044 - pAAV-AiE0779m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias...CN3044) minBG SYFP2 Control AIBS , Ting 191720 AiP13038 - pAAV-AiE0743m_3xC2-minBG-SYFP2-WPRE3-BGHpA (...: CN3038) minBG SYFP2 Control AIBS , Ting 191728 AiP12408 - pAAV-AiE0600m-minBG-SYFP2-WPRE3-BGHpA (Alias... CN2408) minBG SYFP2 Control AIBS , Ting 199773 AiP13863 - pAAV-AiE0888m_C4-minBG-SYFP2-WPRE3-BGHpA (Alias...

...Foff 2.0-EYFP EF1a EYFP Cre dependent 8 Deisseroth 137164 pAAV-nEF-Con/Fon/Von eYFP nEF EYFP Cre, Flp ... EGFP Constitutive 5 Haydon 104055 pAAV-CAG-eYFP CAG EYFP Constitutive 2, 5, rg*, PHP.eB Gradinaru 104061...Constitutive 5 Khakh 105622 pAAV.CamKII(1.3).eYFP.WPRE.hGH CamKII(1.3) eYFP Constitutive 1 Deisseroth 105921 pAAV-CBh-mKate2... 1, 2, 5, 8, 9, rg* Deisseroth 117382 hSyn1-eYFP hSyn eYFP Constitutive 5, 8, 9, rg*, PHP.eB Gradinaru...Constitutive 9, PHP.eB Feng 27056 pAAV-Ef1a-DIO EYFP EF1a EYFP Cre dependent 1, 2, 5, 9, rg* Deisseroth 28306... dependent 1 Wickersham 104052 pAAV-CAG-DIO-EYFP CAG EYFP Cre dependent PHP.V1 Gradinaru 83895 pAAV-hDlx-Flex-GFP-Fishell..., 8, 9, rg* Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP Flp dependent 1, 2, 5, 8, 9, rg* Deisseroth...

...pAAV-Ef1a-DIO EYFP EF1a EYFP, Cre-dependent Control Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP, Flp-dependent...Fon/Von eYFP nEF EYFP, Cre, Flp and VCre-dependent Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control...Cre-dependent Control Roth 55650 pAAV-hSyn Con/Fon EYFP Syn EYFP, Cre and Flp-dependent Control Deisseroth 28306...Dlx dTomato Control Fishell 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 112677 pOTTC1032 - pAAV EF1a... 3.0-EYFP EF1a Inhibitor, Cre-dependent Optogenetics Deisseroth 26973 pAAV-hSyn-hChR2(H134R)-EYFP Syn ...Deisseroth 20298 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA EF1a Activator, Cre-dependent Optogenetics... Deisseroth 55645 pAAV-hSyn Con/Fon hChR2(H134R)-EYFP Syn Activator, Cre and Flp-dependent Optogenetics...

...C-terminal His tag SYFP2 Yellow Mammalian Express a gene of interest fused to the C-terminus of SYFP2 Clover Green... EYFP connected by 8 GGSGGS repeats pET28CLY9 Peptide linker standard consisting of ECFP and EYFP connected...pET28CLY1 Peptide linker standard consisting of ECFP and EYFP connected by 1 flexible glycine- and serine-containing...pET28CLY2 Peptide linker standard consisting of ECFP and EYFP connected by 2 GGSGGS repeats pET28CLY3 Peptide ...Peptide linker standard consisting of ECFP and EYFP connected by 3 GGSGGS repeats pET28CLY4 Peptide linker standard... standard consisting of ECFP and EYFP connected by 4 GGSGGS repeats pET28CLY5 Peptide linker standard ...standard consisting of ECFP and EYFP connected by 5 GGSGGS repeats pET28CLY6 Peptide linker standard consisting...

...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1 Gradinaru...

...Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-F GTGGACTCTTGTTCCAAACTGG F1...

...Llama 135219 HS22 pEYFPN1 anti-Homer1 nanobody HS22 Homer1 Mouse Llama 135220 HC20 pEYFPN1 anti-Homer1 nanobody...Llama 135221 HS38 pEYFPN1 anti-Homer1 nanobody HS38 Homer1 Mouse Llama 135223 HC87 pEYFPN1 anti-Homer1 nanobody...