We narrowed to 56 results for: yfp
-
TypeBlog Post...Serotype Name Depositor 27056 AAVrg pAAV-Ef1a-DIO EYFP Karl Deisseroth 11447 AAV5 pAAV-Ef1a-fDIO mCherry...
-
Hot Plasmids - August 2020
TypeBlog Post...syn-FLEX-axon-jYCaMP1s. Find these AAVs at Addgene Cre-dependent EYFP AAV in the new serotype PHP.V1 that exhibits efficient... -
Allen Institute for Brain Science AAV Enhancer Collection
TypeCollection...pAAV-AiE2402m-minBG-SYFP2-WPRE3-BGHpA AiP1706 AiE2402m SYFP2 Layer 5_ET Isocortex 223981 pAAV-AiE0464m-minBG-SYFP2-WPRE3...pAAV-AiE0674m-minBG-SYFP2-WPRE3-BGHp AiP12857 AiE0674m SYFP2 Layer 5_ET Isocortex 224017 pAAV-AiE0667m-minBG-SYFP2-WPRE3...Region 230551 pAAV-AiE2638m-minBG-SYFP2-WPRE3-BGHpA AiP2105 AiE2638m SYFP2 Layer 2-3_IT Isocortex 230803 ...Isocortex 214583 pAAV-AiE2543m-minBG-SYFP2-WPRE3-BGHpA AiP1924 AiE2543m SYFP2 Layer 2-3_IT Isocortex 220727 ...Isocortex 224004 pAAV-AiE0680m-minBG-SYFP2-WPRE3-BGHpA AiP12754 AiE0680m SYFP2 Layer 2-3_IT Isocortex 230402 ...223974 pAAV-AiE0050m_3xC2-minCMV-SYFP2-WPRE3-BGHpA AiP12211 AiE0050m_3xC2 SYFP2 Layer 4_IT Isocortex 224056...224038 pAAV-AiE0671m_3xC2-minBG-SYFP2-WPRE3-BGHpA AiP13897 AiE0671m_3xC2 SYFP2 Layer 4_IT Isocortex 220734... -
Optogenetics AAV Preps
TypeCollection...TC)-EYFP nEF ChR2(E123T/T159C) EYFP Flp dependent 8 Karl Deisseroth 26968 pAAV-Ef1a-DIO ChETA-EYFP EF1a...H134R)-eYFP.WPRE.hGH CaMKII ChETA EYFP Constitutive 9 Karl Deisseroth 135633 pAAV-S5E2-C1V1-eYFP E2 C1V1...Fon-Arch3.3-p2a-EYFP nEF Arch3.3 EYFP Flp dependent 8 Karl Deisseroth 20949 pAAV-double floxed-eNpHR-EYFP-WPRE-pA...eNpHR EYFP Cre dependent 9 Karl Deisseroth 26966 AAV-Ef1a-DIO eNpHR 3.0-EYFP EF1a eNpHR 3.0 EYFP Cre dependent... 3.0-EYFP CaMKII eNpHR 3.0 EYFP Constitutive 1, 9 Karl Deisseroth 26972 pAAV-hSyn-eNpHR 3.0-EYFP Syn eNpHR...eNpHR 3.0 EYFP Constitutive 2, 5 Karl Deisseroth 137151 pAAV-nEF-NpHR3.3-EYFP nEF NpHR 3.3 EYFP Constitutive...NpHR3.3-EYFP nEF NpHR 3.3 EYFP Cre dependent 8 Karl Deisseroth 137154 pAAV-nEF-Coff/Fon-NpHR3.3-EYFP nEF ... -
Penn Vector Core Partnership with Addgene
TypeCollection...H134R)-eYFP.WPRE.hGH Optogenetics Karl Deisseroth AV-1-26968P 26968-AAV1 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-1-26971P 26971-AAV1 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics...eNpHR 3.0-EYFP Optogenetics Karl Deisseroth AV-5-26968P 26968-AAV5 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-5-26972P 26972-AAV5 pAAV-hSyn-eNpHR 3.0-EYFP Optogenetics...floxed-eNpHR-EYFP-WPRE-pA Optogenetics Karl Deisseroth AV-9-26966P 26966-AAV9 pAAV-Ef1a-DIO eNpHR 3.0-EYFP Optogenetics...H134R)-eYFP.WPRE.hGH Optogenetics Karl Deisseroth AV-9-26968P 26968-AAV9 pAAV-Ef1a-DIO ChETA-EYFP Optogenetics...pAAV-CaMKIIa-hChR2(H134R)-EYFP Optogenetics Karl Deisseroth AV-9-26971P 26971-AAV9 pAAV-CaMKIIa-eNpHR 3.0-EYFP Optogenetics... -
Deisseroth INTRSECT Collection
TypeCollection...proof-of-concept targeting approach in 2014 1 (using EYFP and ChR2-EYFP as payloads). This approach has been broadly...constructs experimentally. Plasmids In addition to EYFP and ChR2-EYFP, a large number of additional, validated ...Items 55641 pAAV-Ef1a-fDIO EYFP Flp Yes 55640 pAAV-Ef1a-dDIO hChR2(H134R)-EYFP Dre No 55639 pAAV-Ef1a-fDIO...pAAV-Ef1a-fDIO hChR2(H134R)-EYFP Flp Yes 126080 pAAV-Ef1a-sCreDIO hChR2(H134R)-eYFP Scre No 126081 pAAV-Ef1a-vCreDIO...Items 55650 pAAV-hSyn Con/Fon EYFP Cre AND Flp Yes 231926 pAAV-Ef1a-Con/Fon-EYFP Cre AND Flp No 55651 pAAV-hSyn...pAAV-hSyn Con/Foff EYFP Cre AND NOT Flp F3/F5 No 137162 pAAV-Ef1a-Con/Foff 2.0-EYFP Cre AND NOT Flp FRT/...55652 pAAV-hSyn Coff/Fon EYFP Flp AND NOT Cre No 231927 pAAV-Ef1a-Coff/Fon-EYFP Flp AND NOT Cre Yes 137129... -
Caltech Systemic Capsids
TypeCollection...rAAV-DLX2.0-minBG-SYFP2-WPRE3-BGHpA minBetaGlobin SYFP2 Control Ting 163509 CN1839-rAAV-hSyn1-SYFP2-10aa-H2B-WPRE3...Dlx mRuby2 Control Gradinaru 104055 pAAV-CAG-eYFP CAG EYFP Control Gradinaru 104061 CAG-NLS-GFP CAG NLS-GFP...EF1a mCherry Control Deisseroth 117382 hSyn1-eYFP Syn EYFP Control Gradinaru 135630 pAAV-S5E2-dTom-nlsdTom...-BGHpA hSyn1 H2B-SYFP2 Control Ting 191706 AiP13044 - pAAV-AiE0779m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias...: CN3044) minBG SYFP2 Control AIBS , Ting 191707 AiP12237 - pAAV-AiE0452h-minBG-SYFP2-WPRE3-BGHpA (Alias... - pAAV-AiE0743m_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3038) minBG SYFP2 Control AIBS , Ting 191726 AiP12787... - pAAV-AiE0140h_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2787) minBG SYFP2 Control AIBS , Ting 191728 AiP12408... -
Brain Initiative Collection
TypeCollection...-CAG-DIO-EYFP An AAV genome encoding Cre-dependent expression of the fluorescent protein EYFP from the...AAV2 pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...AAV5 pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...AAVrg pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...PHPeB pAAV-CAG-eYFP An AAV genome that ubiquitously expresses the fluorescent protein eYFP from the CAG ...Boyden 117382-AAV2 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter...Gradinaru 117382-AAV5 hSyn1-eYFP An AAV genome that expresses the fluorescent protein eYFP from the hSyn1 promoter... -
Brain Armamentarium
TypeCollection...pAAV-AiE0873m_3xC2-minBG-SYFP2-P2A-3XFLAG-10aa-H2B-WPRE3-BGHpA (Alias: CN4496) Expression of SYFP2 (yellow fluorescent...-minBG-ChR2(H134R)-EYFP-WPRE3-BGHpA (Alias: CN3755) Expression of ChR2(H134R)-EYFP in striatal cholinergic...pAAV-AiE0441h_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3905) Enhancer AAV for expression of SYFP2 in all striatal...pAAV-AiE0888m_C4-minBG-SYFP2-WPRE3-BGHpA (Alias: CN3863) Enhancer AAV for expression of SYFP2 in midbrain dopamine...AiP12610 - pAAV-AiE0780m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2610) Expression of SYFP2 (yellow fluorescent protein...AiP12408 - pAAV-AiE0600m-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2408) Expression of SYFP2 (yellow fluorescent protein...pAAV-AiE0140h_3xC2-minBG-SYFP2-WPRE3-BGHpA (Alias: CN2787) Expression of SYFP2 (yellow fluorescent protein... -
Control AAV Preps
TypeCollection...Constitutive 5 Philip Haydon 104055 pAAV-CAG-eYFP CAG EYFP Constitutive 2, 5, rg*, PHP.eB Viviana Gradinaru...Baljit Khakh 105622 pAAV.CamKII(1.3).eYFP.WPRE.hGH CamKII(1.3) eYFP Constitutive 1 Karl Deisseroth 105921..., 5, 8, 9, rg* Karl Deisseroth 117382 hSyn1-eYFP hSyn eYFP Constitutive 1, 2, 5, 8, 9, rg*, PHP.eB Viviana...dependent 9 Karl Deisseroth 27056 pAAV-Ef1a-DIO EYFP EF1a EYFP Cre dependent 1, 2, 5, 9, rg* Karl Deisseroth...dependent 1 Ian Wickersham 104052 pAAV-CAG-DIO-EYFP CAG EYFP Cre dependent PHP.V1 Viviana Gradinaru 83895...Karl Deisseroth 137162 pAAV-Ef1a-Con/Foff 2.0-EYFP EF1a EYFP Cre dependent 8 Karl Deisseroth 98927 pENN....9, rg* Karl Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP Flp dependent 1, 2, 5, 8, 9, rg* Karl Deisseroth... -
Retrograde AAV viral preps
TypeCollection...pAAV-Ef1a-DIO EYFP EF1a EYFP, Cre-dependent Control Karl Deisseroth 55641 pAAV-Ef1a-fDIO EYFP EF1a EYFP, Flp-dependent...Von eYFP nEF EYFP, Cre, Flp and VCre-dependent Control Karl Deisseroth 117382 hSyn1-eYFP Syn EYFP Control... Control Bryan Roth 55650 pAAV-hSyn Con/Fon EYFP Syn EYFP, Cre and Flp-dependent Control Karl Deisseroth...dTomato Control Gordon Fishell 104055 pAAV-CAG-eYFP CAG EYFP Control Viviana Gradinaru 112677 pOTTC1032 -...H134R)-EYFP EF1a Activator Optogenetics Karl Deisseroth 55645 pAAV-hSyn Con/Fon hChR2(H134R)-EYFP Syn Activator...Deisseroth 20298 pAAV-EF1a-double floxed-hChR2(H134R)-EYFP-WPRE-HGHpA EF1a Activator, Cre-dependent Optogenetics...Optogenetics Karl Deisseroth 26966 pAAV-Ef1a-DIO eNpHR 3.0-EYFP EF1a Inhibitor, Cre-dependent Optogenetics Karl ... -
Fluorescent Proteins: FRET
TypeCollection...sfGFP-pBAD ECFP EYFP 434 0.41 527 67,000 0.67 4.8 1.5 pmECFP-1 , pmEYFP-1 , pECFP18aaEYFP mCerulean mVenus...mNeonGreen-mRuby2-FRET-10 SYFP2 mScarlet3 515 0.68 592 104,000 0.75 6.3 4.8 pSYFP2-C1 , pmScarlet3_C1 , pDx_mScarlet3... pDx_mScarlet3-SYFP2 mVenus mKO2 515 0.64 565 63,800 0.62 5.7 2.9 mVenus N1 , mKO2-N1 mOrange2 mCherry...linkers of varying lengths. Description Article ECFP-EYFP FRET standards, fusion proteins with linkers of ... -
Sequencing Primers
TypeGuide...GTCTTGTAGTTGCCGTCGTC For distinguishing EGFP vs ECFP vs EYFP Reverse F1ori-F GTGGACTCTTGTTCCAAACTGG F1 origin... -
AAV Molecular Tools
TypeCollection...TRE-DIO-eYFP Cre-dependent and Tetracycline-inducible Cre-dependent, Tet-inducible expression of EYFP 1 Viviana... -
Trimmer Lab NeuroMab Collection
TypeCollection...Llama 135219 HS22 pEYFPN1 anti-Homer1 nanobody HS22 Homer1 Mouse Llama 135220 HC20 pEYFPN1 anti-Homer1 nanobody...Llama 135221 HS38 pEYFPN1 anti-Homer1 nanobody HS38 Homer1 Mouse Llama 135223 HC87 pEYFPN1 anti-Homer1 nanobody... -
Empty Backbones - Choosing Your Perfect Plasmid Backbone
TypeCollection...fluorescent reporter gene with cap-dependent 3Myc-EYFP-HA-His6 and IRES-dependent ECFP-HA-His6 translation...