Skip to main content
Addgene
Showing: 41 - 60 of 1033 results
  1. Sequencing Primers

    Type
    Guide
    ... sequencing primer" and "3' sequencing primer". Still not sure what primer you need? Email us at [email protected] GTCTTGTAGTTGCCGTCGTC (Golenbock lab) For distinguishing EGFP vs ECFP vs EYFP, reverse primer F1ori-...primer HAT GAGGAGCACGCTCATGCCCAC (BD Biosciences) Histidine affinity tag, forward primer hGH-PA-R CCAGCTTGGTTCCCAATAGA...
  2. Ras Pathway

    Type
    Collection
    ... the Ras pathway. Ras is a small GTPase and constitutively active Ras is the most common oncogene in human... occur in the Ras gene it can be stuck in a constitutively active form, constantly activating pathways...cell growth and potentially leading to cancer. Constitutively active Ras is the most common oncogene in human...v-akt murine thymoma viral oncogene homolog 3 ALK Anaplastic lymphoma receptor tyrosine kinase ARHGAP35 Rho...MLST8 MTOR associated protein, LST8 homolog MTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 NFE2L2... 1 RALGDS Ral guanine nucleotide dissociation stimulator RAPGEF RAPGEF1 RAPGEF2 Rap guanine nucleotide.... The RAS Initiative - at the National Cancer Institute (NCI) References Ras oncogenes and their downstream...
  3. Lentivirus Plasmids

    Type
    Collection
    ...pLenti CMV Puro DEST 3rd Gateway destination plasmid with constitutive or inducible expression of cDNAs...lentiviral systems Viral production Frequently asked questions about lentivirus use Glossary of commonly used...plasmid. Nolan 12257 pWPXL 2nd EF-1alpha driven constitutive transgene expression, contains intron that gives...expression. Trono 12254 pWPI 2nd EF-1alpha driven constitutive transgene expression and EGFP coexpression. ...inducible shRNA or cDNA expression, gateway plasmid, constitutive Hygromycin resistance gene coexpression. See...Fraser 15948 pLOVE 3rd Tet inducible gateway destination plasmid for cDNA expression Ramalho-Santos 24129...this plasmid. Root Return to Top Do you have suggestions for other plasmids that should be added to this...
  4. CRISPR Guide

    Type
    Collection
    ...PMID: 25398340 Walton, R. T., Christie, K. A., Whittaker, M. N., & Kleinstiver, B. P. (2020). Unconstrained...Publications CRISPR Overview Bacteria have an interesting adaptive immune response that detects and eliminates...DNA with no homology elsewhere in the genome. Realistically, most gRNA targeting sequences will have additional..., a large portion of the Cas9-induced DSBs will still be repaired via NHEJ. The resulting population of...integrase landing site ( attB ) and the other to stimulate DNA repair. This can result in more efficient ...activity. Knockout libraries often target 5′ constitutively expressed exons, while activation and repression...repression, many CRISPR epigenetic tools require constitutive expression of the dCas9 fusion and/or expression...
  5. Rett Syndrome

    Type
    Collection
    ...syndrome is currently based on specific clinical diagnostic criteria, defined as the presence of relatively...gait. Greater than 95% of individuals who meet diagnostic criteria have disease-causing mutations in the...switched on regardless of age or symptom severity, suggesting that restoring MECP2 expression in humans could...that can be differentiated into neurons Coriell Institute: Patient-specific lines (Link opens in a new window... database of clinical features and genetic characteristics of Rett syndrome (Link opens in a new window...Repositories (Link opens in a new window) Coriell Institute - cell line repository, including patient-derived...18337588 Neul et al. 2010. Rett syndrome: revised diagnostic criteria and nomenclature. Ann Neurol . 68, 944...
  6. TALEN Guide

    Type
    Collection
    ...but they still have potential targetable sites approximately every 35bp. Researchers are still determining...dimer, cutting in the spacer region between two distinct ZF target sites. (B) A TAL effector nuclease (...available as a kit from Addgene , custom arrays consisting of 12-31 repeats can be assembled and inserted...Toolbox", from Dr. Feng Zhang’s group at the Broad Institute, will be available from Addgene before the end...to mutate a specific gene or your anxiously investigating gene therapy options for a rare disease in humans...constructs for DNA targeting. Cermak T, Doyle EL, Christian M, Wang L, Zhang Y, Schmidt C, Baller JA, Somia...
  7. All Antibodies

    Type
    Collection
    ...feedback and suggestions for new antibodies to add to the collection using our Antibody Suggestion Form . Browse...recommended applications based on our in-house testing and data provided by trusted outside labs – with...targeting proteins for neuroscience research. Institute for Protein Innovation Collection : Antibodies...Recommended Applications PI Return to Top Do you have suggestions for other antibodies that should be added to ... represent the official views of the National Institutes of Health. Need Some Help? Browse some of our...
  8. AAVED

    Type
    Collection
    ...School Ali Cetin Allen Institute for Brain Science Ben Deverman Broad Institute Katherine Matho Cold Spring...Ali Cetin and Shenqin Yao, Allen Institute Ben Deverman, Broad Institute Katherine Matho, Cold Spring Harbor...Manipulation Meeting Date September 21, 2018 Contact Us Questions? Contact us at [email protected] Sponsor We are...minute presentation, followed by 20 minutes of questions/discussion. The goal of the presentation is to...
  9. AAV Packaged on Request

    Type
    Collection
    ...such as titering, purity assessment, sterility testing, and viral genome sequencing.... process: Titering Purity assessment Sterility testing Viral genome sequencing (VGS) Find detailed pricing...Additional steps, including request approval, your institution’s approval of the MTA, and shipping, mean that...order. MTA Approval 1+ business days, varies by requesting organization Viral vector preps remain subject... typically takes 1–4 days, depending on your institution. AAV Production 6–8 weeks Quality is our priority...Addgene does not perform functional or in vivo testing. We recommend that you consult the original paper...
  10. Zhang Lab CRISPR Page

    Type
    Collection
    ...activation plasmids and screening library CRISPR/Cas9 Synergistic Activation Mediator (SAM) is an engineered protein...the Zhang Lab established Cre-dependent and constitutively expressing Cas9 knockin mice (Platt et al ....sgRNA to a Cre-dependent mouse or sgRNA to a constitutively Cas9-expressing mouse. Described here are AAV...from Jackson Labs: Cre-dependent Cas9 mouse Constitutively active Cas9 mouse Available plasmids are described...plasmid can be digested using SapI, which will reveal sticky ends to enable the rapid ligation of annealed and...
  11. Open Enzyme Collection

    Type
    Collection
    ...site) 165508 pOpen-HindIIIR HindIII 165526 pOpen-PstIR PstI 165528 pOpen-SfiIR (cDNA) SfiI (used to create...pOpen-Eco31IB Eco31IB DNA methyltransferase 165536 pOpen-PstIM M.PstI DNA methyltransferase 165538 pOpen-SfiIM M.SfiI...basic and applied fields as diverse as genomics, diagnostics, biodiversity, synthetic biology, DNA origami...pOpen-BovDNTT Bovine DNTT 165555 pOpen-ALPI CIP (calf intestinal phosphatase) Return to top Additional Resources...
  12. Tetracycline Inducible Expression

    Type
    Collection
    ...promoters had been identified that responded to stimuli, such as hormones or metal ions; however, these...which can result in unintended system induction. Investigate whether or not your serum is tetracycline-free...replaced with tTA, and Puromycin was replaced with Blasticidin selection. Please NOTE, this vector contains ...(rtTA3) expression vector, CMV promoter, and Blasticidin; can be used to make cell lines Tet-On Advanced...Retroviral; CMV-driven; linked via IRES to EGFP-Blasticidin fusion; pMA2641 has rtTA driven by retroviral...Technology (Link opens in a new window) Do you have suggestions for other plasmids that should be added to this...
  13. Plan Your Experiment

    Type
    Collection
    ...such cases, it may be necessary to customize an existing reagent to suit your needs. Genetic Manipulation...expression vector Cas enzyme promoter can be constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); ...genetic knockouts, gRNAs commonly target 5′ constitutively expressed exons, which reduces the chances ...target with no homology elsewhere in the genome. Realistically, a given gRNA target sequence will have partial...protocol associated with the specific plasmid in question (see CRISPR protocols from Addgene depositors ...desired edit, as a large percentage of DSBs are still repaired by NHEJ. How do you determine that your...
  14. Antibody Production

    Type
    Collection
    ... distributed by Addgene were developed by the Institute for Protein Innovation (IPI). For these antibodies...more about these antibodies, please visit the Institute for Protein Innovation Antibody Collection webpage...Quality Control Each lot of antibody undergoes testing, either in-house or through outside labs, to confirm..., freezing at -80 °C, thawing on ice, and then testing for loss of potency against a non-treated control...recommended assays. If an antibody has passed stability testing, it may ship at room temperature. However, Addgene...
  15. Distribution to Industry

    Type
    Collection
    ...HR700_TP53 Exon Mutation Libraries CRISPR Thorsten Stiewe Use these donor vector libraries for CRISPR/Cas9...agreement between the recipient and the depositing institution(s). It governs the transfer of biological materials...distribute plasmids on behalf of the depositing institutions. These agreements indicate the language which... by an authorized signatory at the recipient institution. An authorized signatory is someone who can execute...execute legal documents on behalf of the recipient institution. Once the MTA has been signed, it can be submitted...
  16. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...defines 5 types and 16 subtypes based on shared characteristics and evolutionary similarity. These are grouped...easily packaged in AAV. Cas9 orthologs also have distinct PAM sites that do not cross react, allowing multiple...researchers to further develop the CRISPR toolkit by posting lab protocols , providing tips from experts in ...:1479-91. PMID: 24360272 Chen JS, Dagdas YS, Kleinstiver BP, Welch MM, Sousa AA, Harrington LB, Sternberg.... Science . 337(6096):816-21. PMID: 22745249 Kleinstiver BP, Pattanayak V, Prew MS, Tsai SQ, Nguyen NT...effects. Nature . 529(7587):490-5. PMID: 26735016 Kleinstiver BP, Prew MS, Tsai SQ, Topkar VV, Nguyen NT, Zheng...
  17. Lentiviral Prep Service

    Type
    Collection
    ...Cas9 Cut Blasticidin Expresses human codon-optimized S. pyogenes Cas9 protein and blasticidin resistance...61425 lenti dCAS-VP64_Blast dCAS9 (D10A, N863A) Blasticidin 3rd generation lenti vector encoding dCAS9-VP64...vector, CMV promoter, Hygro Campeau Viral Service Suggestions Don’t see what you are looking for? Please let...viral format by filling out our Viral Service Suggestion Form (Link opens in a new window) . Please note...
  18. Zebrafish Plasmid Collection

    Type
    Collection
    ...Du Lab. A set of pCS2+ backbone-based Gateway destination vectors (pGCS), bearing either amino- or carboxyl-terminal...Neurodegenerative Disorders - Nicholas Cole Lab. A kit consisting of plasmids with four promoters, six fluorophores...resource center based in China focused on collecting existing zebrafish resources and developing new lines and...Center (EZRC) - A repository at the Karlsruhe Institute of Technology (KIT) for the distribution of zebrafish...genomics in zebrafish. Return to top Do you have suggestions for other plasmids that should be added to this...
  19. CRISPR References and Information

    Type
    Collection
    ...CRISPR Genome Editing : John Doench from the Broad Institute gives practical advice for designing your gRNA... by the Doudna Lab at the Innovative Genomics Institute, University of California, Berkeley. CRISPR Software...fruit fly, human, rice fish, mouse, silk worm, stickleback, tobacco, tomato, frog ( X. laevis and X. tropicalis...rabbit, pig, possum, chicken, dog, mosquito, and stickleback. E-CRISP Identifies gRNA target sequences from... , pAC1 , pAC147 , pAC148 , pAC149 ; gateway destination: pAC90 PDF 1.0 MB Katic Nematode: Cas9 and gRNA...
  20. Impact of Genomic Variation on Function (IGVF) Consortium Collection

    Type
    Collection
    ... plasmid tools generated by IGVF Consortium investigators to examine how genomic variation affects genome...phenotype. The National Human Genome Research Institute (NHGRI) is funding this collaborative program ...program that brings together teams of investigators who will use state-of-the-art experimental and computational... funded by the National Human Genome Research Institute (NHGRI) (Link opens in a new window) . Find IGVF...
Showing: 41 - 60 of 1033 results