...factors to consider. First, the titer required is inversely related to transduction efficacy: the higher the...

...during our quality control process. Since MiSeq involves sequence assembly from short reads (<300 bp) which...

...- it is hard to distinguish between specific, invariable expression and non-specific, background signal...

...remains exposed for a longer time. The aerosols are invisible to naked eyes and hence cannot be detected until...

... non-scientists alike, need to stay active and involved if we wish to make positive change. Below I present...

...were able to extravasate from the bloodstream to invade lymph nodes and scan antigen presenting cells, ...

...Harvard Medical School. His projects include investigating negative regulators of T cells and cytokine ...

...model organisms and backgrounds, MoClo can be invaluable for more complex editing and screening experiments...

...deposit, associate the plasmids with a Principal Investigator (PI), provide us with your shipping address ...

...purchased directly from commercial suppliers without investing time and labour on reagent preparation in the ...

... cells of choice. The dedifferentiation stage involves overexpression of four reprogramming factors- ...

...combinatorial mammalian genetics.” Journal of Clinical Investigation 125(4) (2015):1603-19. PubMed PMID: 25751063...

...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer...primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, forward primer Amp-R ...

...BL21 Invitrogen; New England BioLabs E. coli B F dcm ompT hsdS(rB mB) gal ccdB Survival Invitrogen F- mcrA...are now used for a variety of studies used to investigate promoters, small RNAs, or other genetic elements... rpsL (StrR) endA1 nupG tonA::Ptrc ccdA DB3.1 Invitrogen F- gyrA462 endA Delta(sr1-recA) mcrB mrr hsdS20...proA2 rpsL20(StrR) xyl5 lambda- leu mtl1 DH5alpha Invitrogen F- Phi80lacZDeltaM15 Delta(lacZYA-argF) U169 ...rpsL (StrR) rph spoT1 ∆(mrr-hsdRMS-mcrBC) Stbl3 Invitrogen F– mcrB mrr hsdS20 (rB–, mB–) recA13 supE44 ara...proA2 rpsL20 (StrR ) xyl-5 λ– leu mtl-1 Top10 Invitrogen F- mcrA Delta(mrr-hsdRMS-mcrBC) Phi80lacZM15 ...

...Multiplex Genome Engineering Many CRISPR experiments involve editing more than one gene. In these cases, delivering...using Cas9 to generate large genomic deletions or inversions with two gRNA sites on the same chromosome. Most...phases. Chemically or genetically inhibiting genes involved in NHEJ or upregulating those in the HDR pathway...flexible than base editing: it can encode edits involving any new sequence (point mutations, insertions,...for conducting genome-wide screens using CRISPR involves pooled lentiviral CRISPR libraries. Figure 8: ...Modifications Using CRISPR A variation of CRISPRi/a involves dCas9 fused to epigenetic modifiers. These programmable...off-target alterations, such as small mutations or inversions, than do large deletions generated by Cas9 systems...

...renders the virus replication incompetent. E3 is involved in evading host immunity and is not essential ... replication incompetent E3 Non-essential gene involved in immune evasion, deleted to increase packaging...cell line Transfer Vocabulary Term Definition ITR Inverted terminal repeat; Contains elements that promote...

...homologous recombination of unstable regions, such as Invitrogen Stbl3™ or NEB Stable cells. This will ensure ...with which the attP sequences recombine. Visit Invitrogen's website for more information on the Gateway®...

...brain, rendering the experimental procedure less invasive. Different activation wavelengths also make it...Henninger MA, Kodandaramaiah SB, et al. 2014. Noninvasive optical inhibition with a red-shifted microbial...

...engineered receptors to selectively control and investigate cell signaling pathways. Receptors are remotely...

...those cells that pass (“win”) Get a list of genes involved in the selection NEGATIVE screen: Apply library...