...CCCAGTCACGACGTTGTAAAACG (Invitrogen) In lacZ gene M13/pUC Reverse AGCGGATAACAATTTCACACAGG (Invitrogen) In lacZ gene...AAATGATAACCATCTCGC (Invitrogen) Polyhedrin promoter, forward primer Polyhedrin reverse GTCCAAGTTTCCCTG (Invitrogen) For...Used Primers CMV Forward CGCAAATGGGCGGTAGGCGTG (Invitrogen) Human CMV immediate early promoter, forward ...Full Primer List 3'AOX1 GCAAATGGCATTCTGACATCC (Invitrogen) For Pichia vectors with AOX1 terminator, reverse...reverse primer 5'AOX1 GACTGGTTCCAATTGACAAGC (Invitrogen) For Pichia vectors with AOX1 promoter, forward...promoter, forward primer AC5 ACACAAAGCCGCTCCATCAG (Invitrogen) Drosophila Actin 5C promoter, forward primer...primer Alpha-factor TACTATTGCCAGCATTGCTGC (Invitrogen) Alpha factor signal sequence, forward primer Amp-R ...