Skip to main content
Addgene
Showing: 1 - 20 of 52 results
  1. COVID-19 Resources

    Type
    Collection
    ...infection, such as ACE2 and TMPRSS2, which are involved in the entry of SARS-CoV and SARS-CoV-2. Find ...protease that primes the SARS-CoV-2 S protein and is involved in virus entry into cells. ( 2 ) FURIN - an enzyme...superfamily, binds to the SARS-CoV-2 S protein and is involved in virus entry into cells. ( 4 ) Cathepsin L -...infectivity.( 6 ) PCP4 - (Purkinje cell protein 4) is involved in beating of airway cilia.( 7 ) Cytokines - SARS-CoV... BSG - Wang, K et al, 2020, BioRxiv SARS-CoV-2 invades host cells via a novel route: CD147-spike protein...
  2. CRISPR Guide

    Type
    Collection
    ...Multiplex Genome Engineering Many CRISPR experiments involve editing more than one gene. In these cases, delivering...using Cas9 to generate large genomic deletions or inversions with two gRNA sites on the same chromosome. Most...phases. Chemically or genetically inhibiting genes involved in NHEJ or upregulating those in the HDR pathway...flexible than base editing: it can encode edits involving any new sequence (point mutations, insertions,...for conducting genome-wide screens using CRISPR involves pooled lentiviral CRISPR libraries. Figure 8: ...Modifications Using CRISPR A variation of CRISPRi/a involves dCas9 fused to epigenetic modifiers. These programmable...off-target alterations, such as small mutations or inversions, than do large deletions generated by Cas9 systems...
  3. CRISPR History and Development for Genome Engineering

    Type
    Collection
    ...as a powerful defensive strategy against viral invaders, and this system is proving to be just as useful...CRISPR-associated (Cas) genes to not only store a record of invading phages but also to destroy the phages upon re-... the foreign DNA and cleaves it to destroy the invader ( Figure 1 ). Figure 1: An overview of the endogenous...to ensure prokaryotic survival, but it is not invincible. Bondy-Denomy et al. identified the first set...
  4. AAV Viral Preps

    Type
    Collection
    ...receive a ready-to-use viral preparation from the inventory below. AAV are distributed as 100 µL solutions...filtering by the serotype needed. Penn Vector Core Inventory The University of Pennsylvania Vector Core (Link...distribution. All items are listed on the Addgene inventory pages above (By Function or By Serotype). Convert...
  5. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...CRISPR plasmids to study the regulatory networks involved in retinal development....Brzezinski Lab CRISPR Collection The Brzezinski lab investigates gene regulation in the context of the developing...aide in their studies of the regulatory networks involved in retinal development the lab utilizes a CRISPR...
  6. Validated gRNA Sequences

    Type
    Collection
    ... Sato inverted GFP A. victoria GAGCGGCCGCTCGAGTCTAG 66582 cut S. pyogenes 26018130 Xue inverted GFP A....26018130 Xue inverted GFP A. victoria GTATCGATACCGTCGACCTCG 66581 cut S. pyogenes 26018130 Xue inverted GFP A...
  7. Zhang Lab CRISPR Page

    Type
    Collection
    ...) is a microbial nuclease system involved in defense against invading phages and plasmids. CRISPR loci...increase targeting efficiency. These plasmids use the inverted terminal repeats (ITR) from AAV serotype 2. SaCas9...
  8. Cre-lox system

    Type
    Collection
    ...three types of rearrangements: inversion, deletion and translocation. Inversion: If the loxP sites are on ...opposite orientations, recombination results in an inversion and the region of DNA between the loxP sites is...binding to these sites can result in excision, inversion or translocation depending on the orientation ...
  9. NETRF

    Type
    Collection
    ...from the NETRF-funded investigators listed below. Depositing Principal Investigators (PIs) PI Institution...
  10. EXPRESs plasmids for human erythrocytes

    Type
    Collection
    ...receptor-ligand interactions that function in the invasion of the human erythrocyte by the blood stage of...Basigin is a receptor essential for erythrocyte invasion by Plasmodium falciparum. Crosnier C et al., Nature...
  11. EXPRESs Plasmids for Plasmodium falciparum

    Type
    Collection
    ...receptor-ligand interactions that function in the invasion of the human erythrocyte by the blood stage of...Basigin is a receptor essential for erythrocyte invasion by Plasmodium falciparum. Crosnier C et al., Nature...
  12. Serotype Testing AAV

    Type
    Collection
    ...experiments. For more information, see our full AAV inventory or our AAV production page . Note: For a list ...100 µL sized sample, please see our Control AAV Inventory . The catalog ID for the 20 µL sized testing sample...
  13. TALENs for Endogenous Human Genes

    Type
    Collection
    ... pairs of TALEN plasmids targeting human genes involved in cancer and epigenetic regulation from the Joung...series of engineered TALENs targeted to human genes involved in cancer and/or epigenetic regulation ( Reyon...
  14. Lentiviral Prep Service

    Type
    Collection
    ...receive a ready-to-use viral preparation from the inventory below. Lentiviruses are distributed as purified...Use pooled CRISPR libraries to screen for genes involved in specific biological processes. For more information...
  15. Ras Pathway

    Type
    Collection
    ...variety of pathways, which ultimately turn on genes involved in cell growth, differentiation and survival. ...Transcription factor Dp TIAM TIAM1 TIAM2 T-cell lymphoma invasion and metastasis TP53 Tumor protein p53 TSC TSC1...
  16. Neurodegeneration Research Collection

    Type
    Collection
    ...symptoms through medication and surgery. PD primarily involves the malfunction and death of dopamine-producing...other large scale studies. Researchers are now investigating the role that these additional genes may play...
  17. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ... experimental design, biosensors can enable investigation of a signaling pathway or measurement of a biomolecule...2011;6(12):e28245. Uwe Sauer Citrate Direct or inverse fluorescent biosensor for citrate (Citron/Citroff...cytosolic High-Performance Intensiometric Direct- and Inverse-Response Genetically Encoded Biosensors for Citrate...
  18. Immunology Research Plasmids and Resources

    Type
    Collection
    ...immunology collection contains plasmids for genes involved in innate and adaptive immune signaling and cell-cell...such as macrophages and neutrophils that attack invading pathogens. Innate immune cells also process and...membrane and can also function as signaling proteins involved in proliferation, cell differentiation, and apoptosis...molecule, major histocompatibility complex, class II invariant chain DHLAG, HLADG, Ia-GAMMA CD8A CD8a molecule...
  19. TREAT-AD Plasmid Collection

    Type
    Collection
    ...valued opportunities for further translational investment. All resources and high-quality research tools...
Showing: 1 - 20 of 52 results