Skip to main content
Addgene
Showing: 21 - 40 of 54 results

  1. Lentiviral Prep Service

    Type
    Collection
    ...library Brunello in lentiGuide-Puro Human sgRNA library in backbone lentiGuide-Puro targeting 19,114 genes and...library Brie in lentiGuide-Puro Mouse sgRNA library in backbone lentiGuide-Puro containing 78,637 unique... genes along with 1000 non-targeting controls Puromycin Doench , Root 73179 Human gRNA pooled library ... genes along with 1000 non-targeting controls Puromycin Doench , Root Human activation pooled libraries...56,762 unique sgRNAs targeting 18,885 human genes Puromycin Doench , Root Human inactivation pooled libraries...human genes along with 500 non-targeting controls Puromycin Doench , Root 92386 Human CRISPR inhibition library...human genes along with 500 non-targeting controls Puromycin Doench , Root Mouse knockout pooled libraries ...

  2. Cre-lox system

    Type
    Collection
    ...See also similar plasmids pSicoR PGK puro , pSicoR-Ef1a-mCh-Puro , pSicoR-Ef1a-mCh and pSicoR-mCh-empty...FRT sites) Mammalian Mombaerts 17408 Puro.Cre empty vector Cre, Puro resistance and miRNA expression PGK...pIC-Cre Cre Bacterial Rajewsky 22776 MSCV CreERT2 puro Cre-ERT2 - Tamoxifen inducible Retroviral Jacks ...neurons Retroviral Luikart 67503 pF CAG luc-EGFP-cre puro Luciferase - EGFP- Cre fusion CAG Mammalian Stringer... AAV Simpson 72255 pCDH-CB-iCre-P2A-tdTomato-T2A-Puro iCre and tdtomato CB Mammalian Oka 72256 pCDH-CB-copGFP-T2A-iCre... Bacterial Mercader Huber 108543 pLV-EF1-Cre-PGK-Puro Cre EF-1 alpha Lentiviral Alcudia 108639 fli1aCreERT2...also similar plasmids pSico PGK GFP and pSico PGK puro Lentiviral Jacks 11579 pSicoR Cre turns off shRNA...

  3. Fujii Lab CRISPR Plasmids

    Type
    Collection
    ...3xFNLDD/pMXs-puro iChIP plasmid, expresses 3xFNLDD in mammalian cells 51240 3xFLAG-dCas9/pMXs-puro Expresses...recognizing a telomere repeat 63590 3xFN-Tel-TAL/pMXs-puro Expresses a 3xFLAG-tagged TAL protein recognizing...repeat. A retroviral expression vector with the puromycin resistance gene 63591 3xFN-Tel-TAL/pMXs-neo Expresses...

  4. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...115182 pLD-puro-Cc-PARK7WT-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115183 pLD-puro-Cc-PARK7V51G-VA... pLD-puro-Cc-PARK7C53A-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115185 pLD-puro-Cc-PARK7H126A-VA...pLD-puro-Cc-PARK7E163K-VA PARK7 His, Flag, Streptactin CMV Parkinson's Mohan Babu 115187 pLD-puro-Cc-CR-PARK7WT-VA...Roussel 133753 pLVX-Puro-TDP-43-WT TARDBP CMV ALS Shawn Ferguson 133754 pLVX-Puro-TDP-43-A90V TARDBP CMV...Ferguson 133755 pLVX-Puro-TDP-43-A315T TARDBP CMV ALS Shawn Ferguson 133756 pLVX-Puro-TDP-43-A382T TARDBP...Ferguson 133757 pLVX-Puro-TDP-43-D169G TARDBP CMV ALS Shawn Ferguson 133758 pLVX-Puro-TDP-43-K263E TARDBP...Ferguson 133759 pLVX-Puro-TDP-43-M337V TARDBP CMV ALS Shawn Ferguson 133760 pLVX-Puro-TDP-43-P112H TARDBP...

  5. Zhang Lab CRISPR Page

    Type
    Collection
    ...targeting efficiency. SpCas9 and SpCas9n with 2a-Puro and 2a-EGFP are also available. 2. SpCas9 (or SpCas9n...2A-EGFP and single guide RNA 62988 : PX459; SpCas9-2A-Puro and single guide RNA 48873 : PX460; SpCas9n (D10A...) and single guide RNA 62987 : PX462; SpCas9n-2A-Puro (D10A nickase) and single guide RNA 48137 : PX165...2 vector system - lentiCas9-Blast and lentiGuide-Puro (sgRNA) Browse the Addgene GeCKO Library CRISPR ...

  6. Luciferase Plasmid Collection

    Type
    Collection
    ...ratiometric imaging David Nelson 212935 pGL4.84(hRlucCP/Puro) RapidResponse(TM) Renilla Vector for investigating...transcription Pete Stecha 212933 pGL4.84(hRlucCP/Puro) Renilla Vector for investigating regions controlling...luciferase Mark Kay 140328 pLenti-PGK-Venus-Fluc (puro) Firefly hPGK Lentiviral expression of Venus-firefly...firefly luciferase Christopher Vakoc 33307 Ubc.Luc.IRES.Puro Firefly Ubc Lentiviral expression of firefly...firefly luciferase Brent Stringer 102320 FUW-RLuc-T2A-PuroR Renilla Ubc Lentiviral Expression of renilla luciferase...

  7. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...Weber 173220 pPBT-peRNA_GG-Puro Mammalian, piggyBac hU6 pegRNA BsmBI No Puromycin Jacob Giehm Mikkelsen 173222...pPBT-PE2-PuroTK-pegRNA_GG Mammalian, piggyBac hU6 pegRNA BsmBI Yes (Cas9 H840A + MMLV RT) PuroTK Jacob Giehm...

  8. Qi Lab CRISPR Page

    Type
    Collection
    ... genome. The pgRNA_humanized also contains a CMV-puro-t2A-mCherry expression cassette, useful for selection...

  9. Tetracycline Inducible Expression

    Type
    Collection
    ...cloning; selection cassette in format: PGK-rtTA-2A-puro; see article for tagged insert options rtTA On Root... shRNA; neomycin selection; plasmid 21915 has puromycin selection TetR On Wiederschain 41393 pCW57.1 Lentiviral...from pCW57.1. rtTA was replaced with tTA, and Puromycin was replaced with Blasticidin selection. Please... interest. tTA Off Sabatini 92099 AAVS1_Puro_Tet3G_3xFLAG_Twin_Strep Bidirectional promoter controls expression...

  11. Sequencing Primers

    Type
    Guide
    ... as pBAD-R, reverse primer Puro-F GCAACCTCCCCTTCTACGAGC 3' end of puromycin resistance gene, forward primer...

  12. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Autophagosome LC3(ATG8) mCherry Maria Harrison 38277 pMXs-puro GFP-p62 Autophagosome Sequestosome-1 EGFP Noboru...Chromatin H2B mRFP Bryan Welm, Zena Werb 21045 pH2B_mCherry_IRES_puro2 Chromatin H2B mCherry Daniel Gerlich 25999...

  13. Protocol - pLKO.1 – TRC Cloning Vector

    Type
    Protocol
    ...kinase promoter drives expression of puromycin. Puro R Puromycin resistance gene for selection of pLKO...sulfate, and puromycin are located in the “Appendix”. F.2. Determining the Optimal Puromycin Concentration...differently to puromycin selection. Addgene strongly recommends that you determine the optimal puromycin concentration...to fresh puromycin-containing media every other day. f. The minimum concentration of puromycin that results...with finer increments of puromycin to determine a more precise optimal puromycin concentration.) F.3. Protocol...expression of the puromycin resistance gene. f. To select for infected cells, add puromycin to the media at...positive control for the puromycin selection. Days 4+: g. Change to fresh puromycin-containing media as needed...

  14. CRISPR/Cas9 FAQs Answered!

    Type
    Blog Post
    ...marker such as puromycin, you can (also) select for the positive colonies by puromycin selection. You ...transfected cells (for example, plasmid with a puromycin resistance cassette, such as PX459). After you...

  15. Visualizing Protein Turnover In Situ

    Type
    Blog Post
    ...Nathans, Daniel. "Puromycin inhibition of protein synthesis: incorporation of puromycin into peptide chains...Yarmolinsky, Michael B., and L. Gabriel. "Inhibition by puromycin of amino acid incorporation into protein." Proceedings...

  16. CRISPR 101: Epigenetics and Editing the Epigenome

    Type
    Blog Post
    ...-dCas9-p300 Core, as well as pLV-dCas9-p300-P2A-PuroR for lentiviral expression. Figure 1: dCas9... deposited pdCas9-DNMT3A-EGFP and pdCas9-DNMT3A-PuroR for targeted cytosine methylation in mammalian cells... cells. Co-expression markers EGFP and PuroR enable sorting and selection of transduced cells. Grant Challen...

  17. Fluorescent CRISPR Reporters: SRIRACCHA and GEmCherry2

    Type
    Blog Post
    ...stably integrate a reporter gene that contains a puromycin resistance gene followed by the target site (the...genome edit:  A donor plasmid that contains a puromycin resistance gene linked to an in-frame H2B-GFP....

  18. 28 Hot Plasmid Technologies from 2015

    Type
    Blog Post
    ...EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2 can be combined with custom-cloned ...a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create a final lentiviral...the genome. In this work, they use AAVS1_Puro_PGK1_3xFLAG_Twin_Strep and nuclease driven recombination ...
Showing: 21 - 40 of 54 results