...changes in a protein.    Cells expressing an RFP reporter plasmid for recombinase activity were exposed...

...) a RFP protein that binds to the 3’ UTR of the reporter mRNA via an MS2 coat protein (NLS-MS2-RFP) the...transcribed, it is bound by both the GFP and the RFP proteins in the nucleus. During the first round of...nucleus (thanks to a NLS on these proteins). The RFP proteins, however, remain bound to the mRNA since...Pre-constructed Entry vectors containing Cas9, EGFP, mCherry, iRFP, tdTomato, luciferase, LacZ, puromycin or CreERT2...vector expressing a separate reporter gene (EGFP, iRFP, IFP1.4, puromycin, neomycin or luciferase) to create...

...measured by knockdown of a constitutely expressed RFP reporter, was variable across bacterial strains, ...

... by red fluorescent proteins such as tdTomato or RFP or blue fluorescent proteins like Cyan. The issue...

...LSSmOrange mRuby2 Red Mammalian Expresses mRuby2 (a RFP variant) commonly used with Clover pGWF1 Cyan &...

...-IRES-EGFP IRES Retroviral pMSCV-pBabeMCS-IRES-RFP IRES Retroviral pMSCV-IRES-YFP II IRES Retroviral...

... CREM CMV Mammalian Green 8401 p224 pCMV-RFP/CREM floxed RFP within CREM CMV Mammalian Green 8403 p153...GFP expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch plasmid Mammalian Green 22799...hsp70l-loxP-mCherry-STOP-loxP-H2B-GFP_cryaa-cerulean Heat-inducible reporter with Cre dependent H2B-RFP expression Zebrafish Stainier 51269 pCAG-loxPSTOPloxP-ZsGreen...and Cre CAG Mammalian Zhang 68477 pTRE:iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, and GFP TRE Mammalian Jacks...Cre None Zebrafish Stankunas 82696 pCRE-iRFP670 Cre and iRFP670 PGK Mammalian Mullen 84032 pHD066 mCherry-Cre...CAG Mammalian Stringer 68448 TOPO rtTA3-2A-Cre iRFP670, Cre, and GFP EFS Lentiviral Jacks 68468 Cas9-2A-Cre...

...LSSmOrange mRuby2 Red Mammalian Expresses mRuby2 (a RFP variant) commonly used with Clover pGWF1 Cyan & Yellow...

...Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP as a reporter...

...pTREtight promoter None Either Elledge 35625 pAAV-Ptet-RFP-shR-rtTA AAV; shRNA cloning vector; for evaluation...

...ATTCCATCTGCACTAGCCACCGCT 74072 interfere S. pyogenes 26829286 Lu rfp AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes...

...Enhanced miRFPs are monomeric and bright Recent series of enhanced monomeric NIR FPs named miRFPs (monomeric...Therefore, we recommend using miRFPs and their enhanced versions named emiRFPs in your applications.  There...set of spectrally distinct (e)miRFPs available. The numbers in (e)miRFP names correspond to the maxima...multicolor NIR imaging.  Small miRFPnano A separate class of NIR FPs, named miRFPnanos, were derived from cyanobacteriochrome...advantages are their small size (17 kDa for miRFPnanos, 35 kDa for miRFPs, and 27 kDa for EGFP) and a possibility... of the N- and C-termini. Latest miRFPnanos9 do not yield to (m)iRFPs in cellular and molecular brightness.... FRET biosensors were developed based on miRFP760-miRFP720 FRET pair, including Rac1 biosensor (Shcherbakova...

...phytochome-derived proteins, iRFP670, iRFP682, iRFP702, iRFP713 and iRFP720, is that they absorb and emit...near-infrared fluorescent proteins (FPs), called PAiRFP1 and PAiRFP2, to the in vivo imaging toolbox, which increase...application of near-infrared fluorescent proteins, iRFP670 and iRFP720, as photoacoustic contrast agents for two-color...that near-infrared range, and that’s exactly what iRFPs achieved. Those proteins allowed a signal-to-background...

.... 2013 Vladislav Verkhusha iRFP GAF domains from miRFP709 and miRFP670, pair with common PAS domain.... Huang Near-Infrared iRFP iSplit, comprised of PAS and GAF domains of iRFP713. Requires presence of ...

...change that placesTagRFP-T and Dronpa in close proximity. By monitoring changes in TagRFP-T fluorescence...FLINC)-based biosensors measure fluctuations of TagRFP-T fluorescence intensity due to interactions with...membrane in living cells using a construct in which TagRFP-T and Dronpa flanked a PKA substrate fused to the...

...plasmids encoding a fusion between cPYP and tgRFP (PLL7.0 tgRFP cPYP), and plasmids that encode the protein...In dark adapted cells expressing these plasmids, tgRFP fluorescence localizes to the mitochondria, because...

... containing several types of fluorescent (EGFP, tagRFP, mCherry) and nonfluorescent (Halo, SNAP) tags,...NanoLuc), fluorescent proteins (TagGFP2, TagBFP, TagRFP, and T2A-TurboGFP-PEST), and small epitope tags...

...can fold in <10min at 37°C, mCherry takes ~15min, TagRFP ~100min and DsRed ~10hours. Temperature: FPs maturation...is set as 1. Some proteins are very dim (e.g. TagRFP657, which has a brightness of 0.1) and this should...

...small monomeric NIR fluorescent proteins (miRFP670nano and miRFP720) and the Ca2+-sensing domain from Twitch...

...flux by pH-sensitive fluorescence (pMRX-IP-GFP-LC3-RFP) An Autophagic Flux Probe that Releases an Internal...Mizushima Autophagy Autophagosome maturation reporter (pmRFP-LC3) Dissection of the autophagosome maturation ...