Skip to main content
Addgene
Showing: 1 - 18 of 18 results

  1. Fluorescent Protein Guide: Subcellular Localization

    Type
    Collection
    ...Walther Mothes 1817 Lamp1-RFP Lysosomes Lamp1 RFP Walther Mothes 79806 pTag-RFP-C-h-Rab11a-c-Myc Recycling... paxillin GFP Rick Horwitz 26720 RFP-zyxin Focal Adhesions Zyxin RFP Anna Huttenlocher 11908 pEGFP-N1 ...AcGFP Gia Voeltz 79802 pTag-RFP-C-h-Rab5a-c-Myc Early endosomes Rab5a TagRFP James Johnson 79801 pTag-BFP-C-h-Rab5a-c-Myc...James Johnson 79800 pTag-RFP-C-h-Rab4a-c-Myc Recycling endosomes Rab4a TagRFP James Johnson 79799 pTag-BFP-C-h-Rab4a-c-Myc...Filaments LifeAct miRFP703 Vladislav Verkhusha 79994 pEB3-miRFP703 Microtubules EB3 miRFP703 Vladislav Verkhusha...GFP Pantelis Tsoulfas 80000 pMito-miRFP703 Mitochondria COX8A miRFP703 Vladislav Verkhusha 36208 pmTurquoise2...H2A mScarlet Dorus Gadella 18982 pHIV-H2BmRFP Chromatin H2B mRFP Bryan Welm, Zena Werb 21045 pH2B_mCherry_IRES_puro2...

  2. Cre-lox system

    Type
    Collection
    ... CREM CMV Mammalian Green 8401 p224 pCMV-RFP/CREM floxed RFP within CREM CMV Mammalian Green 8403 p153...GFP expression Mammalian Cepko 8389 p212 pCMV-EGFP/RFP EGFP-dsRed gene switch plasmid Mammalian Green 22799...hsp70l-loxP-mCherry-STOP-loxP-H2B-GFP_cryaa-cerulean Heat-inducible reporter with Cre dependent H2B-RFP expression Zebrafish Stainier 51269 pCAG-loxPSTOPloxP-ZsGreen...and Cre CAG Mammalian Zhang 68477 pTRE:iRFP670-EFS:Cre-2A-GFP iRFP670, Cre, and GFP TRE Mammalian Jacks...Cre None Zebrafish Stankunas 82696 pCRE-iRFP670 Cre and iRFP670 PGK Mammalian Mullen 84032 pHD066 mCherry-Cre...CAG Mammalian Stringer 68448 TOPO rtTA3-2A-Cre iRFP670, Cre, and GFP EFS Lentiviral Jacks 68468 Cas9-2A-Cre...

  3. Fluorescent Protein Guide: FRET

    Type
    Collection
    ...LSSmOrange mRuby2 Red Mammalian Expresses mRuby2 (a RFP variant) commonly used with Clover pGWF1 Cyan & Yellow...

  4. Lentivirus Plasmids

    Type
    Collection
    ...Trono 17619 EF.CMV.RFP 2nd EF-1 alpha promoter for transgene and CMV drives expression of RFP as a reporter...

  5. Tetracycline Inducible Expression

    Type
    Collection
    ...pTREtight promoter None Either Elledge 35625 pAAV-Ptet-RFP-shR-rtTA AAV; shRNA cloning vector; for evaluation...

  6. Validated gRNA Sequences

    Type
    Collection
    ...ATTCCATCTGCACTAGCCACCGCT 74072 interfere S. pyogenes 26829286 Lu rfp AAGTTCGTATGGAAGGTTCCGTTAA 74075 interfere S. pyogenes...

  7. Fluorescent Protein Guide: Biosensors

    Type
    Collection
    ...flux by pH-sensitive fluorescence (pMRX-IP-GFP-LC3-RFP) An Autophagic Flux Probe that Releases an Internal...Mizushima Autophagy Autophagosome maturation reporter (pmRFP-LC3) Dissection of the autophagosome maturation ...

  8. Fluorescent Protein Guide: Empty Backbones

    Type
    Collection
    ...Expression iRFP (aka iRFP713) 690 713 6 4.5 2.8 hr Dimer piRFP - Mammalian Expression pBAD/His-B-iRFP - Bacterial...Mammalian Expression mCyRFP1 528 594 18 5.6 Monomer pNCS-mCyRFP1 - Bacterial Expression mCyRFP1-C1 - Mammalian...Expression mRFP1 584 607 13 4.5 1 hr Monomer pcDNA3-mRFP - Mammalian Expression pMXs-mRFP1 - Mammalian...Expression pTagRFP657-C1 - Mammalian Expression pFA6a-link-yoTagRFP657-Kan - Yeast Expression smURFP + BV 642...Plasmids miRFP670 642 670 12 4.5 Monomer pmiRFP670-N1 - Mammalian Expression pBAD/His-miRFP670 - Bacterial...Expression iRFP670 643 670 13 4 ~5 hr Dimer piRFP670-N1 - Mammalian Expression pBAD/HisB-iRFP670 - Bacterial...Expression iRFP682 663 682 10 4.5 ~5hr Dimer piRFP682-N1 - Mammalian Expression pBAD/HisB-iRFP682 - Bacterial...

  9. Fluorescent Protein Guide: In Vivo Imaging

    Type
    Collection
    ... piRFP682-N1 iRFP702 673/702 7.6 piRFP702-N1 miRFP703 673/703 8 pmiRFP703-N1 miRFP709 683/709 4 pmiRFP709...Find Plasmids iRFP670 643/670 12.7 piRFP670-N1 miRFP670 642/670 12 pmiRFP670-N1 iRFP682 663/682 10.2 piRFP682...pmiRFP709-N1 iRFP (aka iRFP713) 690/713 6.2 piRFP iRFP720 702/720 5.8 piRFP720-N1 iSplit 690/713 5.3 pPAS-...Brightness Find Plasmids PAiRFP1 690/717 (after photoactivation) 3.2 pPAiRFP1-N1 PAiRFP2 692/719 (after photoactivation...BphPs). Spectrally distinct permanently fluorescent iRFP variants have been shown to have high effective ...single or multicolor imaging. Photo-activatable iRFPs can be ‘turned on’ by non-phototoxic far-red light...living animals. Further development of the original iRFP has resulted in a split fluorescence complementation...

  10. Allen Institute for Cell Science Plasmid Collection

    Type
    Collection
    ...AAVS1-mTagRFPT-CAAX AICSDP-42 mTagRFPT CAAX domain of K-Ras Plasma Membrane 114403 LMNB1-mTagRFP-T AICSDP...AICSDP-35 mEGFP NA Cytoplasm 101781 CETN2-mTagRFP-T AICSDP-22 mTagRFP-T Centrin-2 Centrioles 101782 LAMP1-mEGFP...protein PMP34 Peroxisomes 101785 TUBA1B-mTagRFP-T AICSDP-28 mTagRFP-T Alpha-tubulin Microtubules 101786 ST6GAL1...Alpha-actinin-2 Sarcomeric z-disks 124608 NPM1-mTagRFP-T AICSDP-69 mTagRFP-T Nucleophosmin Nucleolus (granular component...AICSDP-29 mTagRFPT Lamin B1 Nuclear envelope 114404 AAVS1-mEGFP (PGK) AICSDP-36 mEGFP NA Cytoplasm 114405...

  11. Penn Vector Core Partnership with Addgene

    Type
    Collection
    ....CB7.CI.TurboRFP.WPRE.RBG James M. Wilson AV-9-PV2177 105548-AAV9 pENN.AAV.CMVs.TurboRFP.WPRE.RBG James... M. Wilson AV-1-PV2177 105548-AAV1 pENN.AAV.CMVs.TurboRFP.WPRE.RBG James M. Wilson AV-1-PV2642 105552-...105552-AAV1 pENN.AAV.hSyn.TurboRFP.WPRE.RBG James M. Wilson AV-1-PV2975 105622-AAV1 pAAV.CamKII(1.3).eYFP.WPRE.hGH... M. Wilson AV-5-PV2177 105548-AAV5 pENN.AAV.CMVs.TurboRFP.WPRE.RBG James M. Wilson AV-5-PV2213 105547-... M. Wilson AV-8-PV2177 105548-AAV8 pENN.AAV.CMVs.TurboRFP.WPRE.RBG James M. Wilson AV-9-27056 27056-AAV9... M. Wilson AV-5-PV2642 105552-AAV5 pENN.AAV.hSyn.TurboRFP.WPRE.RBG James M. Wilson AV-5-PV2820 100838-... M. Wilson AV-9-PV2642 105552-AAV9 pENN.AAV.hSyn.TurboRFP.WPRE.RBG James M. Wilson AV-9-PV3080 100840-...

  12. CRISPR Plasmids - Empty gRNA Vectors

    Type
    Collection
    ...Puro Wolfe pL-CRISPR.EFS.tRFP 57819 Mammalian/Lentiviral BsmBI yes, cut S. pyogenes tagRFP Ebert pFGC-pcoCas9...Wolfe pLKO5.sgRNA.EFS.tRFP657 57824 Mammalian/Lentiviral BsmBI none S. pyogenes tagRFP657 Ebert pL-CRISPR.SFFV.GFP...EGFP Ebert pLKO5.sgRNA.EFS.tRFP 57823 Mammalian/Lentiviral BsmBI none S. pyogenes tagRFP Ebert pL-CRISPR.SFFV.tRFP...Mammalian/Lentiviral BsmBI yes, cut S. pyogenes tagRFP Ebert pSAG1::CAS9-U6::sgUPRT 54467 Other/Toxoplasma...

  13. Control AAV Preps

    Type
    Collection
    ...9, rg*, PHP.eB Wilson 105548 pENN.AAV.CMVs.TurboRFP.WPRE.RBG CMV TurboRFP Constitutive 1, 5, 8 Wilson ...Constitutive 5 Wilson 105552 pENN.AAV.hSyn.TurboRFP.WPRE.RBG hSyn TurboRFP Constitutive 1 Wilson 105556...

  14. CRISPR Plasmids - Prime Edit

    Type
    Collection
    ...epegRNA BsaI No mRFP1 David Liu pU6-tmpknot-GG-acceptor Mammalian hU6 epegRNA BsaI No mRFP1 David Liu U6-...pegRNA-GG-acceptor Mammalian hU6 pegRNA BsaI No mRFP1 David Liu QPM-sgR (pTaU3) Plant TaU3 nicking sgRNA...

  15. Neurodegeneration Plasmid Collection

    Type
    Collection
    ...Parkinson's Christien Merrifield 27700 Hip1R-tDimerRFP-N1 Hip1R RFP CMV Parkinson's Christien Merrifield 28195...Lazarou 119693 pBMN iRFP670-OPTN(D474N) OPTN iRFP670 ALS Michael Lazarou 119694 pBMN iRFP670-OPTN(F178A/D474N...Clifford Brangwynne 122441 pHR-FUSN-miRFP670-Cry2WT FUS Cry2WT, miRFP670 SFFV ALS Clifford Brangwynne 122668...D474N) OPTN iRFP670 ALS Michael Lazarou 120163 mCh-KIF5A*-strep KIF5A mCherry, Streptavidin CMV ALS Juan...

  16. Luciferase Plasmids

    Type
    Collection
    ...104587 pHIV-iRFP720-E2A-Luc Firefly EF1α Lentiviral expression of firefly luciferase and iRFP720 from a bicistronic...

  17. Adenovirus Plasmids

    Type
    Collection
    ...Zhang 50957 RedTrackCMV Shuttle For production of mRFP-trackable viruses containing transgene under CMV...
Showing: 1 - 18 of 18 results