Skip to main content

We narrowed to 394 results for: promoter

Showing: 361 - 380 of 394 results
  1. Chemogenetics Plasmids

    Type
    Collection
    ...ID Plasmid Description Gene/Insert Vector Type Promoter Eligible for Viral Packaging PI Additional Resources...
  2. CRISPR Plasmids and Resources

    Type
    Collection
    ... Edit Base editors precisely edit DNA without promoting DSB formation. Delete Cascade-Cas3 generates large...
  3. E11 Bio PRISM Collection

    Type
    Collection
    ...the barcode proteins under the constitutive CAG promoter (Addgene #242764–242781), but E11 Bio has also...
  4. Typing CRISPR Systems

    Type
    Blog Post
    ...because it can process multiple gRNAs under a single promoter, allowing for easy multiplexing. The double-stranded...
  5. CRISPR Guide

    Type
    Collection
    ...are often used to change an amino acid, turn a promoter on/off, or add small protein tags. Precise Modifications... editors include several fused components that promote the intended repair pathway or inhibit unwanted... converting cytidine to uridine. However, they promote the base excision repair pathway, which fully removes...improved PE2/PE3 to inhibit mismatch repair to promote desired edit epegRNA — addition of a structured...while activation and repression libraries target promoter or enhancer regions. As each library is unique...transcriptional repressors or activators and targeting promoter regions. You might sometimes see these referred...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation...
  6. Biosensor AAV Preps

    Type
    Collection
    ...calcium sensors, under the control of various promoters. Sensor Green Calcium Sensors GCaMP8 axon-GCaMP8...ASAP ATP Sensors iATPSnFR2 5-HT Sensors GRAB_5-HT Promoter CAG CaMKII Dlx EF1a GFAP/GfaABC1D minBG Synapsin...AAV9 Retrograde AAV PHPeB Clear Filters ID Name Promoter Sensor Label Activity Serotype PI Acetylcholine...
  7. Viral Vector Guides and Plasmids

    Type
    Collection
    ...modifications to these plasmids, such as different promoters or tags, can even direct delivery of the genetic...
  8. Optogenetics AAV Preps

    Type
    Collection
    ...stGtACR iC++ OPN3 PdCO PPO Bidirectional BiPOLES Promoter CAG CaMKII CBA Dlx E2 regulatory element EF1a/...AAV5 AAV8 AAV9 AAVrg PHPeB Clear Filters ID Name Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2...
  9. Chemogenetics AAV Preps

    Type
    Collection
    ...) DREADD hM4D(Gi) DREADD KOR DREADD PSAM4 GlyR Promoter Synapsin CaMKIIa CD68 Dlx GFAP nEF CAG E2 regulatory...
  10. AAV Packaged on Request

    Type
    Collection
    ...information on its performance. ID Plasmid Gene/Insert Promoter PI Additional Resources Viral Vector Production...
  11. p53 Pathway

    Type
    Collection
    ... the best-characterized effects of p53 are in promoting cell cycle arrest, apoptosis, or senescence in...
  12. Retrograde AAV viral preps

    Type
    Collection
    ...Inhibitors Other Molecular Tools Clear Filters ID Name Promoter Activity Category PI 37825 AAV-CAG-GFP CAG GFP...
  13. Deisseroth INTRSECT Collection

    Type
    Collection
    .... 2016. Serotonin engages an anxiety and fear-promoting circuit in the extended amygdala. Nature 537(7618...
  14. Plasmids for Stem Cell Research

    Type
    Collection
    ...lentiviral plasmids The acetyllysine reader BRD3R promotes human nuclear reprogramming and regulates mitosis...
  15. Promoters

    Type
    Guide
    ...Reference Promoters Promoters Prokaryotic Promoters Eukaryotic Promoters Resources A promoter is a region...a eukaryotic promoter: the core promoter, the proximal promoter, and the distal promoter (Figure 4). Figure...Eukaryotic Promoters Eukaryotic promoters are much more complex and diverse than prokaryotic promoters and span...bind. Distal Promoter The final portion of the promoter region is called the distal promoter, which is upstream...elements, insulators, and silencers. Bacterial Promoters Promoters in bacteria contain two short DNA sequences... binding to the promoter region. Each sigma factor recognizes different core promoter sequences. Figure.... Common Bacterial Promoters Researchers often incorporate the following promoters into plasmids to drive...
  16. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter Forward 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter Forward AC5 ACACAAAGCCGCTCCATCAG...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13 Forward...araBAD promoter Forward pBAD Reverse GATTTAATCTGTATCAGG For vectors with E. coli araBAD promoter Reverse... ATTTAGGTGACACTATAG SP6 promoter Forward T3 GCAATTAACCCTCACTAAAGG T3 promoter Forward T7 TAATACGACTCACTATAGGG... AUG1 promoter Forward AUG1 Reverse GAAGAGAAAAACATTAGTTGGC For Pichia vectors with AUG1 promoter Reverse... shock promoter Forward EF-1α Forward TCAAGCCTCAGACAGTGGTTC Human elongation factor-1α promoter Forward...cerevisiae GAL1 promoter Forward Gal10pro-F GGTGGTAATGCCATGTAATATG S. cerevisiae GAL10 promoter Forward Gal4...
  17. Molecular Biology Reference

    Type
    Guide
    ...downstream from a promoter to drive expression of the inserted gene. Insert The gene, promoter, or other DNA...particular plasmid. Promoter Region Drives transcription of the insert. The promoter recruits transcriptional...strength of the promoter can control the level of insert expression, as a strong promoter directs high expression...weaker promoters can direct low/endogenous expression levels. For more information about promoters, check...resources, including: Molecular Cloning Techniques Promoters Sequencing Primers Origins of Molecular Genetics... for a variety of studies used to investigate promoters, small RNAs, and other genetic elements. Plasmid...check out our promoters reference page . Selectable Marker Used to select for cells that have successfully...
Showing: 361 - 380 of 394 results