Skip to main content
Addgene
Showing: 361 - 380 of 395 results

  3. CRISPR Plasmids and Resources

    Type
    Collection
    ... Edit Base editors precisely edit DNA without promoting DSB formation. Nick Mutated Cas nickase enzymes...

  4. CRISPR Plasmids - gRNAs

    Type
    Collection
    ... or repression experiments use targets within promoters. Do you have gRNAs you'd like to add to the Addgene...

  5. Brzezinski Lab CRISPR Collection

    Type
    Collection
    ...features and pX458 modifications: replacement of Cbh promoter with EF1alpha addition of mCherry reporter variant...

  7. Biosensor AAV Preps

    Type
    Collection
    ...calcium sensors, under the control of various promoters. Sensor Green Calcium Sensors GCaMP8 axon-GCaMP8...2P ATP Sensors iATPSnFR2 5-HT Sensors GRAB_5-HT Promoter CAG CaMKIIa Dlx EF1a GFAP/GfaABC1D Synapsin E2...AAV9 Retrograde AAV PHPeB Clear Filters ID Name Promoter Sensor Label Activity Serotype PI Acetylcholine...

  8. Optogenetics AAV Preps

    Type
    Collection
    ...stGtACR iC++ OPN3 PdCO PPO Bidirectional BiPOLES Promoter CAG CaMKII CBA Dlx EF1a/nEF Synapsin E2 regulatory...AAV5 AAV8 AAV9 AAVrg PHPeB Clear Filters ID Name Promoter Opsin Variant Tag Activity Serotype PI 20071 pACAGW-ChR2...

  9. CRISPR Guide

    Type
    Collection
    ...are often used to change an amino acid, turn a promoter on/off, or add small protein tags. Precise Modifications... editors include several fused components that promote the intended repair pathway or inhibit unwanted... converting cytidine to uridine. However, they promote the base excision repair pathway, which fully removes...improved PE2/PE3 to inhibit mismatch repair to promote desired edit epegRNA - addition of a structured...while activation and repression libraries target promoter or enhancer regions. As each library is unique...transcriptional repressors or activators and targeting promoter regions. You might sometimes see these referred...the methylation state of cytosines in a gene’s promoter or by inducing histone acetylation or demethylation...

  10. AAVED

    Type
    Collection
    ...Circuit Tracing Ali Cetin 12:00 PM Lunch 1:00 PM Promoter/Enhancer Specificity, Serotype specificity, AAV...

  11. Chemogenetics AAV Preps

    Type
    Collection
    ...Inhibitory hM4D(Gi) DREADD KOR DREADD PSAM4 GlyR Promoter Synapsin CaMKIIa CD68 Dlx GFAP nEF CAG E2 regulatory...

  12. AAV Packaged on Request

    Type
    Collection
    ...information on its performance. ID Plasmid Gene/Insert Promoter PI Additional Resources Viral Vector Production...

  13. Genomic Deletions in Mammalian Cell Lines

    Type
    Collection
    ... 20-mer is not G. sgRNA expression from the U6 promoter of the pX330 vector is enhanced by the inclusion...each sample and sequence each colony using a U6 promoter forward primer: CGTAACTTGAAAGTATTTCGATTTCTTGGC...

  14. p53 Pathway

    Type
    Collection
    ... the best-characterized effects of p53 are in promoting cell cycle arrest, apoptosis, or senescence in...

  16. Retrograde AAV viral preps

    Type
    Collection
    ...Inhibitors Other Molecular Tools Clear Filters ID Name Promoter Activity Category PI 37825 AAV-CAG-GFP CAG GFP...

  17. Deisseroth INTRSECT Collection

    Type
    Collection
    .... 2016. Serotonin engages an anxiety and fear-promoting circuit in the extended amygdala. Nature 537(7618...

  18. Promoters

    Type
    Guide
    ...Reference Molecular Biology Reference Promoters Promoters Definition A promoter is a region of DNA where transcription...silencers. Promoter Regions There are three main portions that make up a promoter: core promoter, proximal...Proximal Promoter Further upstream from the core promoter you will find the proximal promoter which contains...bind. Distal Promoter The final portion of the promoter region is called the distal promoter which is upstream...Specific Drosophila promoter containing Gal4 binding sites Bacterial Promoters Promoters in bacteria contain...tryptophan Promoter from E. coli tryptophan operon Ptac Regulated like the lac promoter Hybrid promoter of lac...The Promoter Region-Let's Go Plasmids 101: Inducible Promoters Plasmids 101: Repressible Promoters Plasmids...

  19. Sequencing Primers

    Type
    Guide
    ...vectors with AOX1 promoter, forward primer 35S promoter CTATCCTTCGCAAGACCCTTC CaMV 35S promoter, forward primer... early promoter, forward primer LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward...ATTTAGGTGACACTATAG SP6 promoter, forward primer T3 GCAATTAACCCTCACTAAAGG T3 promoter, forward primer T7 TAATACGACTCACTATAGGG...Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC (BD Biosciences) Human CMV promoter, forward...metallothionein 1 promoter, forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer...Nopaline synthase promoter, forward primer Nmt1-F GCAATGTGCAGCGAAACTAA S. pombe nmt1 promoter, forward primer...baculovirus vector with polyhedrin promoter, reverse primer pQE promoter CCCGAAAAGTGCCACCTG (Qiagen) 5' of...

  20. Molecular Biology Reference

    Type
    Guide
    ...human cells, the promoter will be a human or mammalian promoter sequence. The promoter can also direct ...tissue-specific promoter (e.g., a liver-specific promoter). The strength of the promoter is also important...particular plasmid. Promoter Region Drives transcription of the insert. The promoter is designed to recruit...expression (i.e., a strong promoter directs high expression, whereas weaker promoters can direct low/endogenous...information about promoters, both bacterial and eukaryotic, as well as common promoters used in research...contain a promoter sequence, a transcription terminator sequence, and the inserted gene. The promoter region... of Replication Plasmids 101: The Promoter Region-Let’s Go Promoters Reference Page Plasmids 101: How ...
Showing: 361 - 380 of 395 results