...Ayoubi, R., Southern, K., Laflamme, C., Virk, H., NeuroSGC/YCharOS/EDDU Collaborative Group, & ABIF Consortium...

...homolog MTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 NFE2L2 Nuclear factor, erythroid 2 like 2 ...oncogene homolog Muscle RAS oncogene homolog Neuroblastoma RAS viral (v-ras) oncogene homolog RASA RASA1...

...receptors. Chemogenetic receptors are popular in neuroscience, where they can be used to interrogate brain... function and examine the relationship between neuronal signaling and behavior. Depending on the signalling...

...photoactivatable transcription systems to induce neuronal differentiation. Nat Methods 14:963–966 . https...

...construct ; pMA122 (negative selection marker); pGH8 (neuronal co-injection marker); pCFJ104 (body wall muscle... 2 vector system: lentiCas9-Blast and lentiGuide-Puro packaging plasmids: pVSVg , psPAX2 positive control...

...Optogenetics is typically used in neuroscience to control electrical potentials in neurons. See our Optogenetics ...

...transgene delivery to projection neurons. Specific classes of projection neurons can be targeted by using this...

...control of neuronal activity. Table 1. Descriptions of DREADDs and their activity in neurons DREADD Receptor...activates neuronal activity. Figure 2. PSAM4-based LGICs, their effect, and outcome in neurons. Please ...their activity in neurons PSAM Ion Pore Domain Ligand(s) Effect Outcome (in neurons) Reference PSAM4 Gly...influx Neuronal activation Magnus et al, 2019 PSAM Q79G,Q139G Gly PSEM 22S Cl- influx Neuronal inhibition...influx Neuronal activation Magnus et al, 2011 PSAM L141F,Y115F Gly PSEM 89S Cl- influx Neuronal inhibition...be expressed. However, neuronal control through PSAMs is direct, while neuronal control of DREADDs is ...Specificity hSyn1, CaMKIIa Neurons GFAP Glia CD68 Microglia Dlx Interneurons EF1a, CAG General expression...

...semi-quantitative immunoblotting. Journal of Neuroscience Methods, 172(2), 250–254. https://doi.org/10.1016...

...specific subsets of neurons, allowing precise spatiotemporal control of these neurons by turning on and ...expressed in all GABAergic neurons. In this case, the subpopulation of GABAergic neurons being activated by the...engineering to measure and manipulate cells (frequently neurons) and their governing biomolecular processes. The...channelrhodopsin, fused to mCherry, is expressed in neurons (red dots). When exposed to light of the correct...cations flow into the cell (yellow dots), and the neuron is activated. Optogenetics tools can be broadly...and nervous system to better map and understand neuronal circuits. Optogenetic tools have also been used...Drosophila. These tools have been instrumental in neurological disorder research, helping scientists to better...

... Zhang Neurog2 H. sapiens GTCTCTATCACTGATAGGGA 64161 activate S. pyogenes 25619936 Sato Neurog2 H. sapiens...

...with individual laboratories to assemble a Neurodegeneration Research Collection for the scientific research...

...C1orf9-CD4d3+4-bio 73110 JAM1-CD4d3+4-bio 73111 Neuroplastin-CD4d3+4-bio 73112 PGRMC2-CD4d3+4-bio 73113 CD58...

...the pTT3 plasmid backbone which is described by Durocher et al. Nucleic Acids Research 2002 Jan 15;30(2...

...production of viruses containing transgene under Neuron-specific enolase (NSE) promoter Bamburg 50959 ShuttleMCP...

...Use our chemogenetics AAV to chemically induce neuronal activity in specific cell types. See our Chemogenetics...

...protocols see the Addgene Protocols page or the Neuromab Protocols (Link opens in a new window) page. Storage...

...and Port pAc-sgRNA-Cas9 dU6 BspQI Transfection Puromycin yes, cut Ji-Long Liu U6-BbsI-crRNA dU6 BbsI Transfection...

...11 mTOR Mechanistic target of rapamycin NF1 Neurofibromin 1 PRAS40 Also known as AKT1S1; AKT1 substrate...

... genome. The pgRNA_humanized also contains a CMV-puro-t2A-mCherry expression cassette, useful for selection...